ID: 1158661150

View in Genome Browser
Species Human (GRCh38)
Location 18:59388837-59388859
Sequence GAGGTTAAACAGAAAGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158661149_1158661150 -7 Left 1158661149 18:59388821-59388843 CCAACAAGGCGGTATGGAGGTTA No data
Right 1158661150 18:59388837-59388859 GAGGTTAAACAGAAAGAGTGTGG No data
1158661143_1158661150 28 Left 1158661143 18:59388786-59388808 CCAGATTGTTCTTTTCTTTCAAA No data
Right 1158661150 18:59388837-59388859 GAGGTTAAACAGAAAGAGTGTGG No data
1158661145_1158661150 4 Left 1158661145 18:59388810-59388832 CCAAAAAACAACCAACAAGGCGG No data
Right 1158661150 18:59388837-59388859 GAGGTTAAACAGAAAGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158661150 Original CRISPR GAGGTTAAACAGAAAGAGTG TGG Intergenic
No off target data available for this crispr