ID: 1158665032

View in Genome Browser
Species Human (GRCh38)
Location 18:59424625-59424647
Sequence TTAGTTTTGTAGGGCTACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158665027_1158665032 12 Left 1158665027 18:59424590-59424612 CCATAGATGTGCACCCAGGTATT No data
Right 1158665032 18:59424625-59424647 TTAGTTTTGTAGGGCTACGCAGG No data
1158665029_1158665032 -2 Left 1158665029 18:59424604-59424626 CCAGGTATTTTTTTTTTTCTTTT No data
Right 1158665032 18:59424625-59424647 TTAGTTTTGTAGGGCTACGCAGG No data
1158665024_1158665032 30 Left 1158665024 18:59424572-59424594 CCTCCTGAGTGGCTAAGACCATA No data
Right 1158665032 18:59424625-59424647 TTAGTTTTGTAGGGCTACGCAGG No data
1158665028_1158665032 -1 Left 1158665028 18:59424603-59424625 CCCAGGTATTTTTTTTTTTCTTT No data
Right 1158665032 18:59424625-59424647 TTAGTTTTGTAGGGCTACGCAGG No data
1158665025_1158665032 27 Left 1158665025 18:59424575-59424597 CCTGAGTGGCTAAGACCATAGAT No data
Right 1158665032 18:59424625-59424647 TTAGTTTTGTAGGGCTACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158665032 Original CRISPR TTAGTTTTGTAGGGCTACGC AGG Intergenic
No off target data available for this crispr