ID: 1158665776

View in Genome Browser
Species Human (GRCh38)
Location 18:59431418-59431440
Sequence GTCAAATAACCTTCCTGAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 191}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158665776_1158665779 20 Left 1158665776 18:59431418-59431440 CCTTTTCAGGAAGGTTATTTGAC 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1158665779 18:59431461-59431483 GAGGCTGCTGTGGTTGTTTCTGG 0: 1
1: 0
2: 2
3: 27
4: 276
1158665776_1158665777 1 Left 1158665776 18:59431418-59431440 CCTTTTCAGGAAGGTTATTTGAC 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1158665777 18:59431442-59431464 GATGTTAAGTCTGCAGAATGAGG 0: 1
1: 0
2: 0
3: 10
4: 154
1158665776_1158665780 21 Left 1158665776 18:59431418-59431440 CCTTTTCAGGAAGGTTATTTGAC 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1158665780 18:59431462-59431484 AGGCTGCTGTGGTTGTTTCTGGG 0: 1
1: 0
2: 2
3: 33
4: 254
1158665776_1158665782 28 Left 1158665776 18:59431418-59431440 CCTTTTCAGGAAGGTTATTTGAC 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1158665782 18:59431469-59431491 TGTGGTTGTTTCTGGGGCACAGG 0: 1
1: 0
2: 1
3: 22
4: 257
1158665776_1158665781 22 Left 1158665776 18:59431418-59431440 CCTTTTCAGGAAGGTTATTTGAC 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1158665781 18:59431463-59431485 GGCTGCTGTGGTTGTTTCTGGGG 0: 1
1: 0
2: 7
3: 37
4: 352
1158665776_1158665778 10 Left 1158665776 18:59431418-59431440 CCTTTTCAGGAAGGTTATTTGAC 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1158665778 18:59431451-59431473 TCTGCAGAATGAGGCTGCTGTGG 0: 1
1: 0
2: 0
3: 39
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158665776 Original CRISPR GTCAAATAACCTTCCTGAAA AGG (reversed) Exonic
901896693 1:12319602-12319624 GCCAAACAAACTTCCTGAAAAGG - Exonic
911194073 1:94976219-94976241 GTCAAGTAACTTGCCAGAAAAGG + Exonic
911225939 1:95305668-95305690 GTTATATAATGTTCCTGAAAAGG + Intergenic
913212094 1:116590276-116590298 CTCAAATCACCTTCCTAAGATGG - Intronic
916435117 1:164770906-164770928 TTTAAATTACCTTGCTGAAAAGG - Intronic
916583033 1:166125320-166125342 GTCTAATAACCTGCCTCAATGGG + Intronic
917397438 1:174609255-174609277 GTCAAAATACCTTCCACAAATGG + Intronic
918130442 1:181622812-181622834 CTCAAATAGACTTCCAGAAAAGG - Intronic
918367871 1:183828055-183828077 GTTAAATCACATTCCTGGAAAGG + Intronic
919836336 1:201576226-201576248 TTCATATAACATTCTTGAAATGG - Intergenic
922537740 1:226394445-226394467 GCCAAATTGCCTTCCAGAAAAGG - Intronic
922582055 1:226705828-226705850 CTCAAATGACCTGCCTGACAGGG - Intronic
923508744 1:234630493-234630515 GTCAGAGAACCTCCCTGAAAAGG - Intergenic
923536031 1:234852491-234852513 GTAAAATAAACTTCCTAAATTGG - Intergenic
1063513977 10:6675772-6675794 GTCAAATAACCTACATGAAGTGG - Intergenic
1064273345 10:13884825-13884847 GTCACCTAGCCTTCCAGAAAGGG - Intronic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1065446880 10:25811565-25811587 GTAAAATAAACTTCCAGACATGG + Intergenic
1065762803 10:28998525-28998547 GTTAAATATACTTCTTGAAATGG - Intergenic
1067541119 10:47153852-47153874 AGAAAATAACCTTCCTCAAAGGG - Intergenic
1067556419 10:47276464-47276486 GTCAGACAGCCTTCCTCAAATGG + Intergenic
1068663959 10:59652937-59652959 GTCATAAAACCAACCTGAAAAGG + Exonic
1068717803 10:60207292-60207314 GGCAAAAACCCTTCCTAAAAGGG + Intronic
1070582819 10:77735897-77735919 GTTAAATATACTTCTTGAAATGG - Intergenic
1071751082 10:88476770-88476792 TTTAAAAAACCTTCATGAAAGGG + Intronic
1072986345 10:100144193-100144215 GTTCAAGAACCTTCCAGAAATGG - Intergenic
1076394145 10:130126377-130126399 GTCTCACCACCTTCCTGAAATGG + Intergenic
1077619950 11:3712144-3712166 GTTAAATTAGCTTTCTGAAAGGG - Intronic
1081194036 11:40139562-40139584 GTCAAATGACATTCATTAAAAGG + Intronic
1082766739 11:57174803-57174825 GTCAAATACCCTTTCAGGAAGGG + Intergenic
1083495660 11:63050489-63050511 GTTAAATATACTTCTTGAAATGG + Intergenic
1085662620 11:78383291-78383313 ATGAAATAATCTTCCAGAAAAGG + Intronic
1087595282 11:100245798-100245820 GTCAAACAACATTCCTTAAGTGG - Intronic
1088614307 11:111608870-111608892 GCCAAATTACCCTCCAGAAAAGG + Intronic
1089984417 11:122799639-122799661 GTCAAATAACTTTCCTGTTTTGG + Intronic
1092856985 12:12683556-12683578 GTAATAAAACCTTCCTCAAAGGG + Intronic
1093460059 12:19399964-19399986 GATTAATAAACTTCCTGAAATGG + Intergenic
1093794313 12:23292819-23292841 GTGAAATAACCTTTCTGAAGAGG - Intergenic
1096564225 12:52463223-52463245 GTGAAATCACCTCCCTGAAGTGG - Intergenic
1096865998 12:54563412-54563434 GTCACTTAACCTCCCTGATAAGG + Intronic
1099137030 12:78918313-78918335 GGCAGATAACCTGCCTGGAATGG - Intronic
1099282845 12:80674552-80674574 CTCAAATATCTTTCCTAAAAGGG - Intronic
1099850016 12:88082349-88082371 TTCATATAACCACCCTGAAAGGG + Intronic
1102748460 12:115271180-115271202 GACTAATACACTTCCTGAAATGG - Intergenic
1104579737 12:130002195-130002217 GTCAAATATCCATCCTGACGAGG + Intergenic
1105215339 13:18280902-18280924 CTCAAATCACCTTCCTAACATGG - Intergenic
1105429944 13:20327131-20327153 GTTGTATGACCTTCCTGAAATGG + Intergenic
1106086763 13:26549665-26549687 GTCAAATATCCTTTCTTCAAGGG + Intergenic
1107961619 13:45564215-45564237 TTCAAATAGCCTTACTCAAAAGG + Intronic
1109983796 13:69947946-69947968 CTCAAATAAGCTTACTAAAAGGG + Intronic
1111772447 13:92615547-92615569 GTTATATAGCCTTCCTGAACCGG + Intronic
1112856424 13:103775264-103775286 GTTAAATAACCCTAATGAAATGG - Intergenic
1114886155 14:26854395-26854417 ATCAAAGAACCCTCTTGAAATGG - Intergenic
1115221115 14:31059547-31059569 TTTAAATAACTTTGCTGAAATGG + Intronic
1116392590 14:44411379-44411401 CTCAAATAACCTTTCTGGACAGG + Intergenic
1120511135 14:85415763-85415785 GTCATACAACCTCCTTGAAAAGG + Intergenic
1120648630 14:87103333-87103355 TGCAAATAAACTTCCTGAAGGGG + Intergenic
1123541580 15:21297223-21297245 GTCAAATTACCTTGTTGAAGGGG - Intergenic
1128654226 15:69448330-69448352 TTCAAAACACCTTCCTAAAATGG - Exonic
1129917604 15:79288137-79288159 GTAGAAAAACCTTCCTGAAAGGG + Intergenic
1130180292 15:81620321-81620343 ATAAAACAACCTTCCTGAAAGGG - Intergenic
1202949897 15_KI270727v1_random:24365-24387 GTCAAATTACCTTGTTGAAGGGG - Intergenic
1134902392 16:17950329-17950351 GTCACATCACCTACCAGAAATGG + Intergenic
1141044130 16:80700711-80700733 GTTAAATTACCTTCCCTAAAGGG - Intronic
1144196805 17:12902361-12902383 GTCAAGAAAGCCTCCTGAAAAGG - Intronic
1146761772 17:35484986-35485008 ATCAAATAACCTAGATGAAATGG - Intronic
1146945508 17:36870505-36870527 GTAAAATAATCTTCCTCATATGG + Intergenic
1155228391 18:23750260-23750282 TTCAAATAAACTTCCTTCAAAGG + Intronic
1155578689 18:27278316-27278338 GTCATTTAACCTTCCTGAGCCGG + Intergenic
1156387715 18:36621050-36621072 ATCAAATCACCCTTCTGAAATGG - Intronic
1158615801 18:58985595-58985617 GTTAAATATACTTCTTGAAATGG - Exonic
1158665776 18:59431418-59431440 GTCAAATAACCTTCCTGAAAAGG - Exonic
1158806371 18:60978432-60978454 GTCCAATATCCTTCCTGATTGGG + Intergenic
1159860252 18:73640144-73640166 GTTAAAGAAGATTCCTGAAAAGG + Intergenic
1161712939 19:5860044-5860066 GCCAGATAAGCTTCCTGGAATGG + Intergenic
1164527408 19:29022313-29022335 ATCAAATAAGAATCCTGAAAAGG - Intergenic
1164983697 19:32632702-32632724 GACAAATTCGCTTCCTGAAAAGG + Intronic
926702781 2:15814932-15814954 CTGAAAGAACATTCCTGAAAGGG + Intergenic
926952841 2:18262232-18262254 GTTAAATATACTTCTTGAAATGG + Intronic
928832284 2:35501671-35501693 GTCAATAAAGCTTACTGAAAGGG - Intergenic
929639518 2:43562824-43562846 GTTAGATAACCTACATGAAATGG - Intronic
929686224 2:44037405-44037427 GTCAAATCAACTTGCTGGAAAGG - Intergenic
930288088 2:49459376-49459398 GTCAACTAACATTTGTGAAAGGG + Intergenic
932281395 2:70495548-70495570 GTCAAATAAATTACCTTAAAAGG + Intronic
933228787 2:79781773-79781795 GTAAAATAACAATTCTGAAATGG + Intronic
933677890 2:85073965-85073987 GTTAAATAACCTTGGTAAAATGG - Intergenic
934113266 2:88761919-88761941 GTCAAAGCTCCTTCCTGAGAAGG - Intergenic
934298986 2:91765835-91765857 CTCAAATCACCTTCCTAAGATGG + Intergenic
934613003 2:95754631-95754653 GTTAAATTACATTCCTGGAATGG - Intergenic
935076156 2:99746621-99746643 ATGAAATATCGTTCCTGAAATGG + Intronic
935895246 2:107730111-107730133 CTCATATAACATTCTTGAAATGG + Intergenic
935956672 2:108383733-108383755 GTGTAATAACCTGCCTGTAAGGG - Intronic
936643641 2:114344453-114344475 GTCAAATAAGCCTCCTGTTAGGG + Intergenic
936732197 2:115396233-115396255 GTAAAATACTCTTCTTGAAAAGG - Intronic
941686659 2:168455452-168455474 CTCAACTAACCTCTCTGAAAAGG - Intergenic
943387228 2:187217042-187217064 GTCAAAAGACCCTCCAGAAAGGG + Intergenic
944092246 2:195924705-195924727 CTCACATAAGCTTTCTGAAAGGG + Intronic
945529486 2:210932707-210932729 GCCCAATAACCTTGCTGAACAGG - Intergenic
946920700 2:224578890-224578912 ATCATATAATCTTCCTGAACTGG + Intronic
947308619 2:228775903-228775925 AACAAATAACCTTACTTAAAAGG + Intergenic
1169295591 20:4394628-4394650 GTCAAATAAATTTCCCAAAATGG + Intergenic
1170803445 20:19609726-19609748 GTCAGGTAAACTACCTGAAATGG - Intronic
1171965262 20:31525071-31525093 GCCAAATTACCCTCCCGAAAAGG + Intronic
1173357473 20:42307455-42307477 TTCAAATAAACTTCCTGATGGGG + Intronic
1174619199 20:51861269-51861291 GTGAAATCACGTACCTGAAATGG - Intergenic
1175292202 20:57883349-57883371 GTTAAATTTCCTTCCTGAAGTGG - Intergenic
1176957839 21:15126771-15126793 GTTAAATAATCTTTCTGAGATGG - Intergenic
1177995692 21:28094393-28094415 CTCAAATAACCTTGCTGCAATGG + Intergenic
951054938 3:18136519-18136541 ATTAAGTAACCTTCCTGATATGG - Intronic
951651200 3:24953554-24953576 GTCAAAACACCTACCTGCAATGG + Intergenic
951972983 3:28469264-28469286 GAAAAATAACCTTCATTAAAAGG + Intronic
953926174 3:46983633-46983655 TTCAGTTTACCTTCCTGAAATGG + Intronic
954871415 3:53770050-53770072 GTCAAATAAACTTAAGGAAAAGG - Intronic
956023118 3:64953236-64953258 TTCAAATCACCTTCCAGAATAGG - Intergenic
956312053 3:67892238-67892260 GTCAAATAACTTTCCACAGAAGG - Intergenic
956981904 3:74648725-74648747 GTCCAAGAACATTCCTGAATGGG - Intergenic
957535862 3:81502660-81502682 CTCAAATAACCTGCTTGAAAAGG - Intronic
958525335 3:95251611-95251633 GTAAAATAAACTTTCTGAATTGG - Intergenic
958762752 3:98328543-98328565 GCCAAATAGCCTTCAGGAAAGGG - Intergenic
958785966 3:98596582-98596604 TTCATAAAACCTCCCTGAAATGG - Intergenic
959559994 3:107768421-107768443 TTCAAATCATCTTCATGAAAGGG + Intronic
963613316 3:147500951-147500973 CTTAAATAACTTTCCTTAAATGG - Intronic
964123855 3:153215739-153215761 GTCAAACAACCTTCCTATAAAGG - Intergenic
964288612 3:155150151-155150173 GTCAAATATTATTTCTGAAATGG + Intronic
966130364 3:176630856-176630878 ATCATTTTACCTTCCTGAAAGGG + Intergenic
967031663 3:185613189-185613211 GTCAACGAACTTTTCTGAAAAGG - Intronic
967108263 3:186271160-186271182 GGCACTTAGCCTTCCTGAAAAGG - Intronic
972862146 4:43182759-43182781 AACAGATAACCTTCCTGAATCGG + Intergenic
974609579 4:64198874-64198896 ATAAAATACCCTTGCTGAAAAGG + Intergenic
975744753 4:77465180-77465202 GTCAAATAAATCACCTGAAAGGG - Intergenic
979975418 4:127190236-127190258 TGCAAATAACCTTCATAAAAAGG - Intergenic
980429337 4:132671128-132671150 TTCACATCACCTTGCTGAAATGG + Intergenic
982741594 4:159062431-159062453 GTCAATTATCTTACCTGAAAAGG - Intergenic
983822329 4:172211306-172211328 TACAAATAACCCTCCTGAGAAGG - Intronic
984401622 4:179272681-179272703 GTCAGATAACCTGACTGAACAGG - Intergenic
984819086 4:183864284-183864306 GCAGAATAACATTCCTGAAAGGG - Intronic
986038831 5:3967164-3967186 TTCACATAACATTCATGAAATGG - Intergenic
986252825 5:6076365-6076387 GTCAATTACCTTTGCTGAAAGGG - Intergenic
987237369 5:15956600-15956622 GTCAAATAGCCTTCCAAAAAAGG + Intergenic
987598179 5:20028943-20028965 TTCAAATAATAATCCTGAAATGG - Intronic
990851093 5:60205575-60205597 CTCCAAAAACTTTCCTGAAAAGG + Intronic
992083437 5:73256729-73256751 GTAAAATAACATTTCTCAAAAGG + Intergenic
992461419 5:76964198-76964220 GTCATAAAACATTCCTGTAAAGG + Intronic
996414791 5:123198640-123198662 CCCAAATTATCTTCCTGAAAAGG + Intergenic
996919643 5:128752690-128752712 GTCTAAAGACCTTCCTAAAATGG - Intronic
997023819 5:130034211-130034233 TTCAAATAACATACTTGAAATGG + Intronic
997248001 5:132367609-132367631 ATCAGATAACATTCCTGAAAGGG - Intergenic
998705664 5:144757119-144757141 ATTAAATATCCTTCCTAAAATGG - Intergenic
999622505 5:153487291-153487313 GCCAAAAAACCTTCCTTAAGGGG - Intergenic
1000560723 5:162785543-162785565 GGCATATCACCTTCCTGTAATGG - Intergenic
1003135770 6:3433804-3433826 TTCATATAACCTTCCAGAATAGG + Intronic
1004113438 6:12744208-12744230 GTCAAATTTGCTTCCTTAAAGGG + Intronic
1004386354 6:15176177-15176199 GTCGTATAAAGTTCCTGAAATGG + Intergenic
1005521316 6:26603129-26603151 GTAAAATAACCTTGTTGGAATGG - Intergenic
1006696973 6:35939565-35939587 GTCAATTAAACCTCCTGATATGG + Intergenic
1008224184 6:48892164-48892186 ATCACATAACCTACCTGACATGG + Intergenic
1009496859 6:64359991-64360013 CTCTACTAACCTTCCTCAAATGG + Intronic
1010678504 6:78771686-78771708 GCCAAATAACCTTGCTTAAATGG - Intergenic
1010990874 6:82478741-82478763 GTCAGATGACGTTTCTGAAAAGG + Intergenic
1014675264 6:124356618-124356640 GTCACGGCACCTTCCTGAAAAGG - Intronic
1016362509 6:143283362-143283384 GCCAAATCAGCTTCCAGAAATGG - Intronic
1016627648 6:146191122-146191144 ATCAATGAAGCTTCCTGAAAGGG - Intronic
1017680658 6:156861113-156861135 GTCACCTATCCTTCCTGCAAAGG - Intronic
1017814037 6:158004091-158004113 ATCAAATTACCTTGCCGAAAGGG + Intronic
1020860038 7:13480750-13480772 GTGAAATCAACTTACTGAAATGG - Intergenic
1020998553 7:15297404-15297426 GTCAAATATCATTACAGAAATGG + Intronic
1021176113 7:17451350-17451372 CTCAAATAACCTTCTTAAATAGG + Intergenic
1022609337 7:31853635-31853657 TCCAAATATCCTTCCTGAAGTGG - Intronic
1023243386 7:38174661-38174683 GACAAATAACCTGAATGAAAAGG - Intergenic
1023649221 7:42351137-42351159 GTCAGATAATCTTCTTGGAATGG - Intergenic
1026140671 7:67703614-67703636 GTCAAATTACTTTCCTTGAAAGG - Intergenic
1028046225 7:86122807-86122829 TTAAAATAACCTTAATGAAAAGG + Intergenic
1029793716 7:102871965-102871987 CTCAAATAATCTACCTAAAATGG + Intronic
1029896231 7:103988567-103988589 GTCATACAGCCCTCCTGAAAGGG - Intronic
1031276334 7:119728076-119728098 GGCAAATAAATTTCCTAAAATGG + Intergenic
1031397358 7:121289483-121289505 TTCAAATAACTTTTCAGAAATGG + Intronic
1031839524 7:126720483-126720505 GACAGAAAACCTTCCTGACAAGG + Intronic
1033783796 7:144705182-144705204 TTCATATAACATTCTTGAAATGG + Intronic
1033886228 7:145949806-145949828 GGCAAATAACATTTCTGGAAAGG + Intergenic
1034698806 7:153078746-153078768 GTCAAAGAACCATCCTCATAAGG - Intergenic
1035884783 8:3279964-3279986 TCCAAGTAACCTTCCTGATACGG - Intronic
1037321518 8:17647988-17648010 GTTAAATCACTTTCCAGAAAAGG + Intronic
1042286443 8:67117204-67117226 GTCAAATAACTGTTATGAAAGGG - Intronic
1043215789 8:77585862-77585884 GATAAATAATCTTCCTCAAATGG - Intergenic
1045613300 8:103874118-103874140 GTCAGAGAACCTTCCCCAAATGG - Intronic
1046060491 8:109133847-109133869 GTCAAGTAACATTCTTTAAATGG + Intergenic
1046240220 8:111479992-111480014 GTTAAATGGGCTTCCTGAAAAGG - Intergenic
1046802277 8:118441730-118441752 GTCACATAACCCTGCTGAAATGG - Intronic
1048419998 8:134268756-134268778 GCCAAACAGCCTTCCTGAATGGG - Intergenic
1048741571 8:137566710-137566732 TTCAAGCAAGCTTCCTGAAAAGG + Intergenic
1048790407 8:138098503-138098525 GTAAAATAAGCTTTGTGAAAAGG + Intergenic
1050086342 9:1970242-1970264 GTCATAGAACCTACCTGAAAGGG - Intergenic
1055796436 9:79979447-79979469 GCCAAACACCATTCCTGAAAAGG - Intergenic
1056150096 9:83777428-83777450 ATCAAATAAAACTCCTGAAAAGG + Intronic
1058772845 9:108254599-108254621 ATCACATTACCTTCCTGATAGGG + Intergenic
1059470545 9:114502149-114502171 GACACATAACCTGCCTGACATGG - Intronic
1059561729 9:115341008-115341030 GTCAAGTAACCTGCCTGAGGTGG - Intronic
1060833567 9:126737307-126737329 ATTAAATAACCTACATGAAAAGG + Intergenic
1188154806 X:26727957-26727979 GTAAAATAGGCTTCCTGGAAAGG + Intergenic
1188645910 X:32567055-32567077 GTCAATACACCTTCCTGAAAAGG + Intronic
1189620490 X:42831954-42831976 ATTAAATAACCATCCAGAAAGGG - Intergenic
1192661173 X:73044521-73044543 GTGAAATAACTTTCTTGAATAGG - Intergenic
1194538275 X:95135731-95135753 GTCAAATTTTCCTCCTGAAATGG - Intergenic
1195589994 X:106612948-106612970 GTCAAACACACTTCCTGAATTGG - Intronic
1196760426 X:119196207-119196229 GGCAAATTACTTTGCTGAAATGG - Intergenic
1197284204 X:124576785-124576807 GTCAAATATCATTCATAAAAGGG - Intronic
1198261352 X:134967556-134967578 GTCAAATTATTTTCCAGAAAGGG + Intergenic
1199268876 X:145859373-145859395 ATCAAATAAGTTTCCTGAAAAGG - Intergenic