ID: 1158666211

View in Genome Browser
Species Human (GRCh38)
Location 18:59434946-59434968
Sequence ACCATTAGGTGCCATGATCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158666211_1158666216 5 Left 1158666211 18:59434946-59434968 CCTGGATCATGGCACCTAATGGT 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1158666216 18:59434974-59434996 CTGGGCACCTGCTCAGAACCAGG 0: 1
1: 1
2: 5
3: 44
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158666211 Original CRISPR ACCATTAGGTGCCATGATCC AGG (reversed) Exonic
900658936 1:3773269-3773291 CCCAGGAGGTGCCAGGATCCGGG + Intronic
903404456 1:23084781-23084803 AACATTAACTGCCCTGATCCTGG - Exonic
904409348 1:30315614-30315636 TCCATTAGGAGCAGTGATCCTGG - Intergenic
905015310 1:34774282-34774304 AGCTTTTGGTGCCTTGATCCTGG - Intronic
907917772 1:58886490-58886512 ACCAATATGTGCCATGTTCCAGG - Intergenic
910150502 1:84137371-84137393 ATCATTAGGTGCCAAGGTTCAGG + Intronic
1063890052 10:10619808-10619830 ACCATTTGGTGCCAACATTCTGG + Intergenic
1068807988 10:61221862-61221884 ACCATCAGGTGTCATGTTCAAGG + Intergenic
1076300183 10:129419778-129419800 ACCATTCAGTGCCCTGACCCTGG + Intergenic
1081786629 11:45752251-45752273 ACCATTAGCAGCCATTACCCAGG + Intergenic
1085130208 11:74031827-74031849 AACATTAGGGGCCAGGATCCAGG + Intronic
1091672177 12:2460025-2460047 ACCCTCAGGTGCCATGAGCCAGG - Intronic
1097491643 12:60278987-60279009 ATCATTAGGTGGAATGAACCTGG + Intergenic
1098807910 12:75043760-75043782 GGCATTTGGTGCCATTATCCAGG + Intronic
1099129735 12:78812249-78812271 ACCATTAGGTGAAATGATATTGG + Intergenic
1105959952 13:25323894-25323916 TCCATCAGGTGATATGATCCAGG + Intronic
1112556890 13:100477327-100477349 ACCTTTAGGAGACAGGATCCTGG + Intronic
1113930703 13:113967511-113967533 ACCATCAGGTCCCCAGATCCTGG + Intergenic
1116987798 14:51239950-51239972 ACCATTTGGCGCCAAAATCCTGG + Intergenic
1117283860 14:54266938-54266960 ACCATGCAGTGGCATGATCCTGG - Intergenic
1117729737 14:58710456-58710478 ACTGTTGGGTGCGATGATCCAGG - Intergenic
1120656396 14:87195309-87195331 ACCATTAGGGGCCATTTTGCAGG + Intergenic
1125423862 15:39530663-39530685 ACCATTAGTTTCCATGAGCCTGG - Intergenic
1130713182 15:86304395-86304417 AACATTAGATATCATGATCCGGG - Intronic
1130815791 15:87430890-87430912 ACCATTTGGGGGCATGATCTAGG + Intergenic
1130865182 15:87927517-87927539 ACAATTGGCTGCCATGATCCTGG + Intronic
1131285777 15:91056062-91056084 GCCATTGGGTGCCATCCTCCCGG + Intergenic
1132913590 16:2329364-2329386 TCCATTTGGGGCCATCATCCCGG + Intronic
1133180432 16:4050090-4050112 ACCCTTGGCTGCCATGTTCCTGG + Intronic
1138198311 16:55070628-55070650 ACCATTATGTTCCAAGCTCCTGG - Intergenic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1151496965 17:74463655-74463677 ACCATCAGGTGACATGACTCAGG - Intergenic
1151617974 17:75226813-75226835 TCCATTAGGTGCCAAGAAACAGG - Intronic
1153092848 18:1368505-1368527 ACCAGCTGGTGCCATGATCTTGG - Intergenic
1158666211 18:59434946-59434968 ACCATTAGGTGCCATGATCCAGG - Exonic
1165701213 19:37939578-37939600 ACCATGAGGTGGCAGGATACAGG - Intronic
1166756043 19:45192205-45192227 AGCAGTAGCTGCCATGGTCCTGG - Intronic
1167029752 19:46950085-46950107 ACCATTGGATGCCAGGATACTGG - Intronic
927305264 2:21564132-21564154 AACATGAGGTGCCATGATGGTGG - Intergenic
942453084 2:176120821-176120843 TCCATTCGCTGCCATGGTCCAGG + Intergenic
943139063 2:183955682-183955704 ACAATTATGTGCCTTGAGCCAGG + Intergenic
943479345 2:188398024-188398046 ATCTTTAGATGCCATCATCCAGG + Intronic
943878762 2:193110369-193110391 ACCACTGGGTACCATGATCAAGG + Intergenic
946820074 2:223620258-223620280 GACATTAGGAGCCTTGATCCTGG + Intergenic
947009204 2:225547155-225547177 ACCATTAGGTTTCCTGATTCTGG + Intronic
1168921110 20:1537120-1537142 ACCCTCAGGTACCATGATGCAGG - Intronic
1171186517 20:23127471-23127493 ACCAGTGGGAGCCATGAGCCTGG + Intergenic
1184178729 22:42805155-42805177 ACCACGAGGTGCCAGGAACCAGG + Intronic
954329216 3:49880634-49880656 ACCACTGGGTGCCATGCTCAGGG + Intergenic
954503007 3:51038727-51038749 ACAATAATGTGCCATGAACCAGG - Intronic
956848297 3:73204210-73204232 ACCATTAGGCATCATGATGCTGG + Intergenic
960351255 3:116595951-116595973 ACCATTTCCTGCCTTGATCCAGG + Intronic
969104097 4:4791858-4791880 CCCATTATGTGCCAGCATCCAGG + Intergenic
973843497 4:54887078-54887100 ACGATTACCTGCCAAGATCCAGG - Intergenic
978685135 4:111432867-111432889 GCCAGTAGGTGCCATCCTCCTGG - Intergenic
982964143 4:161880864-161880886 ACCAGTAGTTGCCATGAGGCAGG + Intronic
983139325 4:164129011-164129033 GCCATTAGGTGGGATGAACCAGG - Intronic
986584155 5:9297489-9297511 ACCTTCAGGTGCCTTGTTCCTGG + Intronic
986752049 5:10796023-10796045 AACTCTAGGTGCCTTGATCCTGG - Intergenic
994180742 5:96763285-96763307 ACCATTAGCAGCTATAATCCTGG + Intronic
997904910 5:137807014-137807036 ACCTTTTGGTGCCTTGATCTTGG - Intergenic
1000703545 5:164482884-164482906 CACATTAGGTGCCCTGTTCCAGG + Intergenic
1013632046 6:111995457-111995479 ATCTGTAGGTGCCTTGATCCTGG - Intergenic
1016772329 6:147865425-147865447 ACAATCAGGTGGCCTGATCCGGG - Intergenic
1017547298 6:155466418-155466440 ATCATTGAGTGCCATGTTCCAGG + Intergenic
1023499732 7:40834624-40834646 AAAATTAAGTGCCATGTTCCAGG - Intronic
1028621505 7:92833676-92833698 TCCTTTAGGTGCAATGATTCTGG - Exonic
1028692698 7:93671687-93671709 AACATCAGGTGCCAAGATACAGG - Intronic
1031867697 7:127056547-127056569 ACCATTATGTGCCAGTCTCCAGG - Intronic
1032442839 7:131955262-131955284 AACATTATGTGCCAGGATACAGG - Intergenic
1049849690 8:144824162-144824184 AGCATTTGGGGCCTTGATCCTGG + Intergenic
1052218573 9:25995079-25995101 AACATTTGGTGCCAAGAACCCGG + Intergenic
1053373280 9:37580694-37580716 AACACTGGCTGCCATGATCCAGG + Intronic
1061422483 9:130479859-130479881 ACCATTAGCTGCAACGGTCCAGG - Intronic
1062688067 9:137826565-137826587 ACCAGTAGGTGCCTTGACCTTGG - Intronic
1185488643 X:501604-501626 GCCATTAGGTCCCAGGATGCAGG + Intergenic
1186402200 X:9270312-9270334 ACCAGCAGGAGCCAGGATCCTGG + Intergenic
1186963722 X:14764700-14764722 ATCATTAGGTGCCATCATGGAGG - Intergenic
1187296980 X:18011697-18011719 ACCAGTGGATCCCATGATCCCGG - Intergenic
1192964835 X:76166343-76166365 ACCAGCTGGTGCCATGATCCTGG - Intergenic