ID: 1158666387

View in Genome Browser
Species Human (GRCh38)
Location 18:59436586-59436608
Sequence CTACAAAACCCTATGAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158666387_1158666390 -8 Left 1158666387 18:59436586-59436608 CCCAACTTCATAGGGTTTTGTAG 0: 1
1: 0
2: 1
3: 5
4: 125
Right 1158666390 18:59436601-59436623 TTTTGTAGGATTCATAAGTGAGG 0: 1
1: 0
2: 2
3: 25
4: 242
1158666387_1158666391 19 Left 1158666387 18:59436586-59436608 CCCAACTTCATAGGGTTTTGTAG 0: 1
1: 0
2: 1
3: 5
4: 125
Right 1158666391 18:59436628-59436650 AAGCAAGTAAATACGTGTAAAGG 0: 1
1: 0
2: 1
3: 19
4: 136
1158666387_1158666392 20 Left 1158666387 18:59436586-59436608 CCCAACTTCATAGGGTTTTGTAG 0: 1
1: 0
2: 1
3: 5
4: 125
Right 1158666392 18:59436629-59436651 AGCAAGTAAATACGTGTAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158666387 Original CRISPR CTACAAAACCCTATGAAGTT GGG (reversed) Intronic
902379848 1:16047783-16047805 CAGCAGAACCCTCTGAAGTTAGG - Intronic
907043392 1:51283467-51283489 TTACATAATCCTATGAAGTGGGG - Intergenic
910328059 1:86033482-86033504 CTATAAAACACTAAGAAGTAAGG + Intronic
911727582 1:101258192-101258214 CTAGAGATCCCTTTGAAGTTTGG + Intergenic
918546681 1:185692342-185692364 CTATAAAGCCCCATGAAGTAAGG + Intergenic
919159361 1:193808166-193808188 CTACTAAACCCTGTGTATTTAGG - Intergenic
919474207 1:198014377-198014399 CTACAAAATTCTGTGAAATTTGG - Intergenic
920061526 1:203229975-203229997 CTCCAAAGCCCTATTAAGTCTGG - Intronic
924583126 1:245338885-245338907 CCACAAGACCCTATGTAGTCTGG - Intronic
1066379776 10:34891292-34891314 CAAAGAAACCCTATGAGGTTGGG - Intergenic
1068078169 10:52284571-52284593 CTGCCAAACACTATGAAGTATGG + Intronic
1070324665 10:75380287-75380309 TTACATAACCCTGGGAAGTTGGG + Intergenic
1071739567 10:88341677-88341699 CCACAAAACCCTTTAAAGTATGG - Intronic
1072723209 10:97793606-97793628 CTGCCAAAACCTAGGAAGTTTGG - Intergenic
1074172929 10:110961927-110961949 CAACAAAAGCTTATCAAGTTCGG - Intronic
1076496305 10:130899887-130899909 CTGCGAAACCATCTGAAGTTTGG + Intergenic
1080631133 11:34077207-34077229 ATACAAGACCATGTGAAGTTAGG - Intronic
1085653660 11:78292189-78292211 CTAGAGAATCCTATGAAGTGAGG - Intronic
1089086049 11:115817616-115817638 AAACAAAACTCTCTGAAGTTAGG + Intergenic
1093485944 12:19652754-19652776 CTCCAAAACACTAGGTAGTTAGG - Intronic
1096613898 12:52820821-52820843 CCACAAAACCCAATTAAGTGTGG + Intergenic
1098072677 12:66692975-66692997 TCTCAACACCCTATGAAGTTAGG - Intronic
1098809410 12:75067238-75067260 CAAAAAAAGCCTAAGAAGTTAGG + Intronic
1099258060 12:80340805-80340827 CTACACAGCACTATGAAGTCTGG + Intronic
1104052920 12:125208617-125208639 CTACAAAACACTATGCGGTCCGG - Intronic
1107734419 13:43383120-43383142 CTTCAAAACCCTTTGAGGTCTGG - Intronic
1110570862 13:77001743-77001765 CTACAAAACCCTGGAAAGTTTGG - Exonic
1114995232 14:28342021-28342043 CTACAAAATCTACTGAAGTTAGG + Intergenic
1116358878 14:43967549-43967571 CTACAGAAGCCTTTGAAATTAGG - Intergenic
1117426004 14:55597990-55598012 ATACAAAGCCATATGAAATTAGG - Intronic
1118066571 14:62199029-62199051 CTCCTAAACCCCATGAAGTGTGG + Intergenic
1118227485 14:63915757-63915779 CTACTGAACCCTACGAAGTAAGG - Intronic
1131714985 15:95099147-95099169 CTACAAAAGCATATGAAGTCTGG + Intergenic
1132998746 16:2838604-2838626 CAACAGGACCCTATGAAGGTGGG + Intronic
1135246350 16:20860538-20860560 CACCAAAACCCTATGAAGTAAGG - Intronic
1136582760 16:31163694-31163716 CTAAAAAACCCTCTGAGGCTGGG + Intergenic
1138769527 16:59647592-59647614 CTACAAAATCCTATGTGGTAGGG - Intergenic
1142875098 17:2847561-2847583 CTCCAAAACCCTATTCTGTTTGG - Intronic
1148753144 17:49957482-49957504 CTTCACAACCCTGTGAGGTTGGG + Intergenic
1151032580 17:70758340-70758362 CTACAACATCCTTTGAAGTGTGG + Intergenic
1155001206 18:21688680-21688702 CAATAAAACCCTATGAGGTCAGG + Intronic
1155358233 18:24974463-24974485 TTACAAAACCGTATGAAGTTAGG - Intergenic
1155603238 18:27573487-27573509 ATACCTAACCCTGTGAAGTTTGG + Intergenic
1155793797 18:30007898-30007920 CCACACAATCCTATGAATTTTGG - Intergenic
1156947253 18:42849797-42849819 CTAGAAAACCCTAGGAAGGCAGG + Intronic
1157379604 18:47201301-47201323 CTCAACAACCCTATGAAGTAGGG - Intergenic
1158666387 18:59436586-59436608 CTACAAAACCCTATGAAGTTGGG - Intronic
1159528044 18:69618812-69618834 CAGCTAAACCCTATCAAGTTAGG + Intronic
1163892609 19:20030198-20030220 CTAGAAAACACTATGCATTTTGG - Intronic
925329871 2:3050255-3050277 TCACAAAACCATATGAATTTAGG + Intergenic
927548412 2:23975377-23975399 CTACATAACTGTATGAGGTTTGG + Intronic
928035118 2:27815618-27815640 TTACAACACCCTAGGAAGATGGG + Intronic
928710763 2:34002733-34002755 CTACTAAAAGCGATGAAGTTGGG + Intergenic
928994816 2:37277312-37277334 CTATAAAACTATATGAACTTGGG - Intronic
932645097 2:73492063-73492085 CTACAATACTCTATGAGGTGGGG - Intronic
933915265 2:86985349-86985371 CTCAAAAACCCTATGAATTAAGG - Intronic
934007728 2:87784552-87784574 CTCAAAAACCCTATGAATTAAGG + Intronic
934943925 2:98522440-98522462 TTAAAAAATTCTATGAAGTTTGG + Intronic
935771366 2:106425471-106425493 CTCAAAAACCCTATGAATTAAGG + Intronic
935908707 2:107870478-107870500 CTCAAAAACCCTATGAATTAAGG - Intronic
935995112 2:108762696-108762718 CTCAAAAACCCTATGAATTAAGG - Intronic
936130490 2:109835592-109835614 CTCAAAAACCCTATGAATTAAGG - Intronic
936214207 2:110535893-110535915 CTCAAAAACCCTATGAATTAAGG + Intronic
936423344 2:112390452-112390474 CTCAAAAACCCTATGAATTAAGG + Intronic
937190553 2:120093255-120093277 CTACAAAACCTGAAGAACTTAGG + Exonic
940118945 2:150241030-150241052 CTAGAATAACCTATGATGTTTGG - Intergenic
941210002 2:162625649-162625671 CAACAAAACCCTGTGAGGTGAGG - Intronic
946962098 2:224996317-224996339 CTACAAGTCCCCTTGAAGTTTGG - Intronic
947705717 2:232273824-232273846 CTAGAGAACCTTCTGAAGTTTGG - Intronic
1170744141 20:19083583-19083605 CTGCAAAACTTTATAAAGTTCGG - Intergenic
1173685702 20:44921922-44921944 CTACTAACCCCTATGATGGTTGG - Intronic
1175468093 20:59206703-59206725 CTACAACAACCTCTGAAGCTAGG + Intronic
1178705524 21:34869746-34869768 CTACAAAACCCCTTCAACTTGGG + Intronic
1184328818 22:43812530-43812552 CTACACGGCCCTATGCAGTTCGG - Intergenic
949184644 3:1175528-1175550 CTACAAAGTCCTATATAGTTTGG - Intronic
949203080 3:1404366-1404388 CTACACAATCCTAAGAAGTGAGG - Intergenic
949445144 3:4127273-4127295 CCACAACACCCTGTGAGGTTGGG - Intronic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
959198788 3:103220428-103220450 CTGCAAAAACTGATGAAGTTCGG + Intergenic
961632580 3:128312222-128312244 CTAGACAACCCTGTGAAGTAGGG + Intronic
969712637 4:8852778-8852800 CAACAAAACTCTTTGAAGATAGG + Intronic
972719990 4:41686690-41686712 GCACAAAACCCTATGAGGTAGGG - Intronic
975789348 4:77931833-77931855 CTGCAAAACATTTTGAAGTTCGG - Intronic
979218061 4:118189946-118189968 TTACATAAACCTAGGAAGTTGGG - Intronic
982101942 4:151976506-151976528 CCACTAAACCCTATGAAGACAGG + Intergenic
982633655 4:157865033-157865055 CTAGAAAAGCCTATGAAGAGAGG - Intergenic
983029594 4:162783208-162783230 CAACAAATTCCTTTGAAGTTTGG - Intergenic
983260480 4:165451238-165451260 CTACAGAACCCAAACAAGTTTGG - Intronic
984207257 4:176800099-176800121 TTACAAAAGTCTTTGAAGTTTGG + Intergenic
988601985 5:32648799-32648821 CTACATGACCCCATGAAGCTGGG - Intergenic
990226336 5:53659212-53659234 CAACATAACCCAATGATGTTAGG - Intronic
993484212 5:88462545-88462567 CTACAATGCCCTATGTGGTTGGG - Intergenic
993632505 5:90303089-90303111 CTACCCAACCCCAAGAAGTTAGG + Intergenic
996981894 5:129506925-129506947 CCAAATAACCCTATGAAGTTGGG + Intronic
999212026 5:149897880-149897902 TTAAAAGACCCTATTAAGTTGGG - Intronic
999896424 5:156038922-156038944 CTACAAAACCCTGCTCAGTTTGG + Intronic
1004166060 6:13257402-13257424 TAATAAAACTCTATGAAGTTAGG - Intronic
1005712642 6:28516711-28516733 ACACCAAAACCTATGAAGTTGGG - Intronic
1006913173 6:37577444-37577466 CTACAAAGCCCCCTGAAGCTGGG + Intergenic
1007941052 6:45782099-45782121 CTACAAGACTCTGTGGAGTTGGG - Intergenic
1008112989 6:47513425-47513447 ATGCAAAAACCTATGCAGTTTGG - Intronic
1008303104 6:49866927-49866949 CTACACAATCTTATGGAGTTTGG + Intronic
1008463805 6:51807002-51807024 CTGCAAAAGACTATGAACTTGGG + Intronic
1009050851 6:58274709-58274731 CTTCAAATCTTTATGAAGTTTGG + Intergenic
1009239573 6:61167674-61167696 CTTCAAATCTTTATGAAGTTTGG - Intergenic
1011117906 6:83914881-83914903 CTACAAAAGACTCTTAAGTTTGG - Intronic
1012016699 6:93861544-93861566 CTACTAATCTCTATGAAATTTGG + Intergenic
1014187952 6:118457224-118457246 ATATAATACCCTATGAAGTAGGG - Intergenic
1024454842 7:49593283-49593305 CTACAGAATTCTATGTAGTTAGG - Intergenic
1027737579 7:81953344-81953366 CTACAAAGCCTTATGAGGTCTGG + Intronic
1033247776 7:139732536-139732558 ATACAGACCCCTATGAAGATAGG - Intronic
1039858126 8:41434042-41434064 CTACAAAGCCCCATGATTTTTGG + Intergenic
1041117488 8:54554359-54554381 CTTCAAATCCCTTTGAAGCTGGG - Intergenic
1042232328 8:66570567-66570589 CTACATGACCCTATGAAGGCAGG + Intronic
1043714399 8:83463578-83463600 CTAAAATATCCTATGAACTTAGG + Intergenic
1044036697 8:87312861-87312883 CTAAAAACTCCTGTGAAGTTTGG - Intronic
1045580615 8:103475719-103475741 CTACAAAACCCTATGTGATTTGG - Intergenic
1045859199 8:106796606-106796628 CACCAAAACCCCATAAAGTTGGG - Intergenic
1046644473 8:116769919-116769941 CAAAGTAACCCTATGAAGTTAGG - Intronic
1048250172 8:132859148-132859170 TTACATCATCCTATGAAGTTGGG + Intergenic
1048250175 8:132859208-132859230 TTACATTATCCTATGAAGTTGGG + Intergenic
1051484446 9:17592987-17593009 CTCCCAAACCCTGTGATGTTGGG - Intronic
1056311361 9:85344549-85344571 GTACAAAACACTTTGCAGTTAGG + Intergenic
1057715469 9:97491725-97491747 CTATAAAACCCTGTGAGGTCAGG + Intronic
1059264022 9:113009159-113009181 ATTCAAAACCCTATGAAAATTGG + Intergenic
1059964229 9:119597979-119598001 CCATAAAACCCTATGAGGTATGG + Intergenic
1060086329 9:120706369-120706391 CTACAAAAACCTAGGCACTTAGG + Intronic
1203617991 Un_KI270749v1:87191-87213 CTACAAAAGGCTCTGAAATTGGG + Intergenic
1187669136 X:21651268-21651290 CTACAGAACCCTATGGTTTTTGG + Intronic
1188051715 X:25495888-25495910 CTAGAAAACACTATAAAGTGTGG - Intergenic
1192617028 X:72636304-72636326 CTTCAAAACTCTATGACATTCGG - Exonic
1196123082 X:112070977-112070999 CAAAAAAATCCTGTGAAGTTGGG + Intronic