ID: 1158667431

View in Genome Browser
Species Human (GRCh38)
Location 18:59445205-59445227
Sequence TAATTTTTGCAGATGGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24583
Summary {0: 1, 1: 28, 2: 740, 3: 11060, 4: 12754}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158667431 Original CRISPR TAATTTTTGCAGATGGTGTA AGG Intronic
Too many off-targets to display for this crispr