ID: 1158670329

View in Genome Browser
Species Human (GRCh38)
Location 18:59468503-59468525
Sequence GATCCCTGCCCCATTCACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158670321_1158670329 26 Left 1158670321 18:59468454-59468476 CCTGAGCCTCATGGAATGGCCTG 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1158670329 18:59468503-59468525 GATCCCTGCCCCATTCACTTGGG 0: 1
1: 0
2: 0
3: 17
4: 157
1158670322_1158670329 20 Left 1158670322 18:59468460-59468482 CCTCATGGAATGGCCTGTACCTT 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1158670329 18:59468503-59468525 GATCCCTGCCCCATTCACTTGGG 0: 1
1: 0
2: 0
3: 17
4: 157
1158670326_1158670329 1 Left 1158670326 18:59468479-59468501 CCTTTCTCTGCAGGAGAGGCCAG 0: 1
1: 0
2: 0
3: 24
4: 331
Right 1158670329 18:59468503-59468525 GATCCCTGCCCCATTCACTTGGG 0: 1
1: 0
2: 0
3: 17
4: 157
1158670324_1158670329 7 Left 1158670324 18:59468473-59468495 CCTGTACCTTTCTCTGCAGGAGA 0: 1
1: 0
2: 2
3: 21
4: 196
Right 1158670329 18:59468503-59468525 GATCCCTGCCCCATTCACTTGGG 0: 1
1: 0
2: 0
3: 17
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158670329 Original CRISPR GATCCCTGCCCCATTCACTT GGG Intronic
900638304 1:3676251-3676273 GATCCCTGCCCTATCCCCATGGG - Intronic
901045180 1:6392004-6392026 GAGCCCTGCCCCTTTGACTTTGG - Intronic
903279809 1:22244031-22244053 CATCCCTGCCCCAGTCCTTTTGG + Intergenic
904674487 1:32190468-32190490 GATGCCTGGCCCAGTCATTTGGG - Intronic
905560564 1:38923623-38923645 GACTCCTGCTCCATTCAATTGGG - Intronic
906206790 1:43991457-43991479 GAGCCCTGACCCAAGCACTTTGG - Intronic
908158875 1:61386416-61386438 GATCCCTGCCCCATGCCCTGGGG - Intronic
908770244 1:67589443-67589465 GATCTCTGCACCATTGTCTTGGG + Intergenic
910070317 1:83206257-83206279 GTTCCCTGCCCATTTCCCTTTGG + Intergenic
910202713 1:84715933-84715955 GATCCCTTCTTCATTCACTGTGG - Intergenic
911421682 1:97650092-97650114 GATCCCTCCTCCCTCCACTTAGG + Intronic
911710510 1:101066432-101066454 CATACCTGCCCCATCCACTGTGG - Intergenic
916597133 1:166254642-166254664 CATCCCTTCCCCATTGACTTTGG - Intergenic
917033623 1:170722130-170722152 GAACTCTGCCCTACTCACTTAGG - Intronic
918415595 1:184303628-184303650 GATGGCTACCCCATTCTCTTTGG - Intergenic
920172414 1:204080273-204080295 TAACCCTGCCCCAATCCCTTGGG - Intronic
920398174 1:205661239-205661261 GACACCTGACCCACTCACTTGGG - Intronic
920680660 1:208070016-208070038 GAGCTCTGCCCCACTCACTGTGG - Intronic
1064174825 10:13065725-13065747 AATCCCTGCAACATTCTCTTTGG + Intronic
1065823436 10:29548325-29548347 GATCCCTTCTCAATTCACCTGGG + Intronic
1065968557 10:30787769-30787791 GAGCCCTGAGCCATTCTCTTGGG + Intergenic
1068468063 10:57420980-57421002 GATTCCTGCACCTTTCAGTTGGG + Intergenic
1072636318 10:97180706-97180728 CATCTCTGCCCCTTTCCCTTGGG - Intronic
1081675168 11:44964357-44964379 GACCCCTGCACCGTCCACTTGGG + Intergenic
1081907121 11:46677256-46677278 GCTCACAGCCCCATTCACTGGGG - Exonic
1086252179 11:84829194-84829216 CCTCCCTGCCCCACTCACATAGG + Intronic
1086935891 11:92745688-92745710 GATCCTTGACCAATTCACTTTGG - Intronic
1090389124 11:126375822-126375844 AATCTCTGCCCCACTAACTTTGG - Intronic
1091637552 12:2208949-2208971 GATCCCTGCCCCAGACCCCTGGG + Intronic
1091947435 12:4561114-4561136 GATCCCTGCCCCACTAAACTGGG + Intergenic
1092037963 12:5357062-5357084 CATCCCTGAACCAATCACTTTGG + Intergenic
1092048426 12:5450015-5450037 GATCCTTGCCCCAACCACTAGGG - Intronic
1096995155 12:55833659-55833681 GTGCCCTGCCCCATTCACCTTGG - Intergenic
1100325200 12:93533696-93533718 CATCCCTGCCCAAAACACTTTGG - Intergenic
1100574253 12:95874699-95874721 AATTCCTGTCCCATTCACCTGGG - Intronic
1101316966 12:103638141-103638163 GACCCCTGCCAAATTAACTTTGG + Exonic
1102746287 12:115251728-115251750 CATTCCTGCCACATTCACTGTGG - Intergenic
1103083393 12:118043048-118043070 CCTCCCTGCCCCACTCACGTTGG - Intronic
1106081701 13:26506001-26506023 CATCCCTGCCCCCTACAGTTAGG - Intergenic
1106296037 13:28414677-28414699 GGTGCCTGGCCCAATCACTTGGG + Intronic
1108271221 13:48761384-48761406 CCTTCCTGCCCCATTCCCTTTGG + Intergenic
1111795804 13:92918195-92918217 GACCCTTTCCCCATTCACTGAGG - Intergenic
1113126766 13:106987708-106987730 GATCCCCTCCCCACTTACTTTGG - Intergenic
1113375944 13:109765713-109765735 TATCCCAGCCTCATCCACTTTGG + Intronic
1115650186 14:35397536-35397558 GGTGCCTGCCACAGTCACTTGGG + Intergenic
1117478849 14:56123093-56123115 GATACCTGCCTCATTTCCTTTGG + Intronic
1117737746 14:58784817-58784839 TATTTCTGTCCCATTCACTTTGG - Intergenic
1118516927 14:66540334-66540356 CATCCCTGCTCCACTGACTTTGG - Intronic
1118593398 14:67418447-67418469 CATCCCTGTCCCATTGACTCAGG + Intergenic
1121220000 14:92278014-92278036 GAGCCCTTCCCCAGACACTTTGG - Intergenic
1121344478 14:93125240-93125262 GAGCCCAGCCCCCTACACTTGGG - Intergenic
1124611652 15:31213822-31213844 GACCCCTGCCCAATTCCCTGAGG + Intergenic
1124805338 15:32875977-32875999 TATGCCTGCCCTACTCACTTGGG + Intronic
1128867994 15:71130029-71130051 GTGCTCTGCCCCATTCACTCTGG - Intronic
1129299883 15:74619455-74619477 GATCCCTGCCCTGTCCTCTTTGG + Intronic
1134395846 16:13862711-13862733 CATCCCTGACCCAGTCACTGTGG + Intergenic
1137706149 16:50537269-50537291 GAGGCCTGCTCCATTCTCTTAGG + Intergenic
1138828124 16:60345887-60345909 CATTCATGCCCCATTCTCTTTGG - Intergenic
1138987011 16:62341827-62341849 GAATCCTGTCCCTTTCACTTTGG + Intergenic
1139782472 16:69363445-69363467 GATCTCAGCCCCATCCACTTGGG - Intronic
1144431281 17:15194204-15194226 GATTCCTGCGTCATTCACCTTGG - Intergenic
1145098487 17:20053016-20053038 AATCCCTTACCCATTGACTTGGG - Intronic
1145985508 17:29043254-29043276 GATCCCCGCCCCAATCACAATGG - Exonic
1147453142 17:40518745-40518767 GCTCGCTGCCCCAGGCACTTGGG - Intergenic
1148503226 17:48107592-48107614 GATCCCCCCTCCACTCACTTGGG - Exonic
1149003080 17:51777013-51777035 CATCCCTTCCCTATTCCCTTTGG - Intronic
1149447150 17:56722364-56722386 GATTCCTTCCCCATCAACTTTGG - Intergenic
1150057635 17:62033403-62033425 TTTCCCTGCCCCAATGACTTTGG + Intronic
1151395485 17:73820021-73820043 GATCCCTGCCCCTTCCAAGTTGG - Intergenic
1157692922 18:49698515-49698537 CATCCCTACCCCCTTCACTCAGG - Intergenic
1158670329 18:59468503-59468525 GATCCCTGCCCCATTCACTTGGG + Intronic
1159245451 18:65799278-65799300 TATGTCTGCCCCATTCTCTTGGG - Intronic
1160848468 19:1177778-1177800 GATCTCTGCCACATCCACCTCGG + Intronic
1163366752 19:16879791-16879813 GTCCCCAGCCCCAGTCACTTGGG - Exonic
1163773808 19:19206336-19206358 CCTCCCTGCCCCATTCCCTGGGG - Intergenic
1166153567 19:40893169-40893191 GGTCTCTGCCTCCTTCACTTAGG + Intronic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
925730976 2:6918986-6919008 AACCCCAGCCCCATTCACTGGGG - Intronic
927255959 2:21041174-21041196 GTTCCCAGCACCATTCCCTTTGG - Intronic
929562679 2:42965555-42965577 GATCCCTGCCCCAGTCAAGGAGG + Intergenic
932410017 2:71540920-71540942 GATCCCTGCCTTATTCCCTAAGG - Intronic
932755740 2:74408058-74408080 GAGCCCTGCCCCATTCCTCTAGG + Intergenic
935105333 2:100038301-100038323 GACCCCAACCCCATTCACTTTGG + Intronic
937019221 2:118634905-118634927 AACCCCTGCCACATTCACTTAGG - Intergenic
1169272397 20:4210698-4210720 TTTCCCTGCCCCATTGGCTTTGG + Intergenic
1170746404 20:19102987-19103009 TTTCCCTGCCCCTTTGACTTTGG - Intergenic
1171367804 20:24638101-24638123 GAGCCGTGCCCGCTTCACTTGGG - Intronic
1172898472 20:38316893-38316915 GCTCCCTGTCCCTTCCACTTAGG - Intronic
1174068917 20:47886422-47886444 CATCCCTGCCCCACTGACTTTGG + Intergenic
1175932619 20:62499841-62499863 GATCCCCGCACCTTTAACTTGGG - Intergenic
1177813324 21:25948481-25948503 CAATCCTGCCCCATTCACTATGG + Intronic
1178400592 21:32281727-32281749 CATCCCTGCCCCAATCGCTATGG - Intergenic
1180179095 21:46109991-46110013 GATCCCTGCCCCTTGCAGTTTGG - Intronic
1181032306 22:20154478-20154500 AGCCCCTGCCCCATTCACTCAGG - Intergenic
1182810371 22:33111163-33111185 CAGCCCTCACCCATTCACTTGGG - Intergenic
1183295385 22:37026202-37026224 GATCCCTGCCACATTTACATGGG + Intronic
1183522500 22:38303507-38303529 GACCCTTGCCCCACTCACATCGG - Intronic
1185024266 22:48398692-48398714 CACCCCTGCCCCATCCACTCTGG + Intergenic
952693680 3:36240151-36240173 CATCCCTGCCCCGTTTACTTTGG - Intergenic
952821760 3:37492060-37492082 GATCCCTGCCACACACACTTTGG - Intronic
954857591 3:53659936-53659958 AATCCCTGTCCCAATCATTTTGG + Intronic
955243257 3:57199968-57199990 GATCCCAGCCCTATACACGTGGG - Exonic
961473687 3:127134216-127134238 GCTGCCTGCCCCATTCAGTGGGG - Intergenic
961723509 3:128910997-128911019 CATACCTGCCCCATTCACCAAGG + Intronic
962669981 3:137695044-137695066 GATCCCTGCCTAACTCTCTTTGG + Intergenic
965929198 3:174021966-174021988 GATTTCTGCCCCTTTAACTTGGG - Intronic
967610004 3:191493279-191493301 CATCCCTGTACCATTAACTTTGG + Intergenic
969726453 4:8921039-8921061 GATCCCTGCCACCTTCACTGGGG - Intergenic
971535435 4:27742612-27742634 GAACCTTGGCTCATTCACTTAGG + Intergenic
971918876 4:32910376-32910398 GCTCCATTCCCCATTCACCTTGG - Intergenic
972350675 4:38233484-38233506 CTTCCCTGCCCCATTGATTTAGG - Intergenic
973203732 4:47535363-47535385 AATCTCTGGCCCATTTACTTTGG - Intronic
975716874 4:77213705-77213727 GATCCATGTCCTATTCTCTTTGG + Intronic
979987300 4:127330916-127330938 CCTCCCTGCCCTATGCACTTGGG + Intergenic
981045507 4:140261478-140261500 CATGCCTTCCCCATTCATTTGGG + Intronic
981647102 4:147011652-147011674 AATCCCTGCCGCCTTCACTGGGG - Intergenic
983485211 4:168324451-168324473 GATGCCTGCCCATTTCAGTTTGG + Intergenic
984413510 4:179427511-179427533 GTTCCCTGTCACTTTCACTTTGG - Intergenic
988093231 5:26569223-26569245 GGGGCCTGCCCCATTCACCTAGG + Intergenic
989687054 5:44101916-44101938 TATCCCCTCCCCATTCATTTTGG - Intergenic
991301694 5:65134686-65134708 TTTCCCTGCCCCATTGACTTTGG - Intergenic
997963754 5:138341558-138341580 AATCCCTGCCCCCTTCCTTTTGG - Intronic
998480714 5:142460417-142460439 GATCCCAGTCCTATTCAGTTAGG + Intergenic
998643380 5:144037012-144037034 GATTACTCCACCATTCACTTAGG + Intergenic
998737179 5:145155504-145155526 GAACCCTGCCTAATACACTTAGG + Intergenic
999183839 5:149690728-149690750 GAGCCCTGCCCTACTCACTCAGG + Intergenic
999275663 5:150328461-150328483 GACCCCTGCCCACTCCACTTCGG + Intronic
1000145847 5:158452555-158452577 GATCCCTGCCCCTTCAACTGGGG + Intergenic
1002174999 5:177396734-177396756 CTTCCCTGCCCCCTTCACCTGGG + Exonic
1002640148 5:180626888-180626910 GTTCCCTGCCTCCTTCATTTGGG + Intronic
1004916521 6:20337994-20338016 GACCTCTGCCCCATTCACACAGG - Intergenic
1005903754 6:30242415-30242437 GACCCCTGCCCACTGCACTTTGG - Intergenic
1006941742 6:37756209-37756231 GAGCCCTGCCCCCTTCACTGAGG - Intergenic
1007257612 6:40539825-40539847 GGTCCCTGCCCTACTCACTGTGG + Intronic
1007604018 6:43103530-43103552 GATCCTTCCTCCTTTCACTTGGG - Intronic
1008848930 6:56000648-56000670 TATCCCTGAGCCATTCACTCTGG + Intergenic
1012654971 6:101806025-101806047 GAACCCAGCCCAATTCACTGTGG + Intronic
1015238058 6:130993518-130993540 AACCCCTGCCCCATCCTCTTTGG - Intronic
1015267625 6:131304340-131304362 GTTCCTTCCCCCATTCTCTTTGG - Intergenic
1016342592 6:143079910-143079932 TATCCCTGCCCCATGCTCTCTGG + Intronic
1018788951 6:167131477-167131499 GGTCCCAGCCCCACTCACCTGGG + Intronic
1022271280 7:28810334-28810356 CCTCCCTGCCCCACTCTCTTTGG - Intronic
1023356877 7:39375898-39375920 CATCCCTGCCCCTTTCAAGTAGG + Intronic
1027004864 7:74684539-74684561 CTTCCCTGCACCCTTCACTTGGG - Intronic
1027024411 7:74840600-74840622 CTTCCCTGCACCCTTCACTTGGG + Intronic
1027063354 7:75103522-75103544 CTTCCCTGCACCCTTCACTTGGG - Intronic
1027288031 7:76671117-76671139 GTTCCCTGCCCATTTCCCTTTGG + Intergenic
1028757454 7:94454079-94454101 GGTCCCTGACCCAATCTCTTGGG - Intergenic
1029509627 7:100985869-100985891 GAACCCTGCCACCCTCACTTTGG + Intronic
1032392296 7:131563403-131563425 GATTCCTGCTGCATTCACTCCGG + Intergenic
1033560191 7:142523481-142523503 AATGCCTTCCCCATTCTCTTAGG + Intergenic
1035220991 7:157406507-157406529 CCTCCCTCCCCCACTCACTTGGG - Intronic
1035314162 7:157987897-157987919 GATCCCTGCTGCATTAACGTGGG - Intronic
1036750047 8:11438059-11438081 GAGCCCTGACCCATCCACCTTGG + Exonic
1041328781 8:56699576-56699598 TATCCCTGCCCCATCTACTGAGG - Intergenic
1043882416 8:85559913-85559935 GCTCCCTGACCCATACTCTTGGG + Intergenic
1043940629 8:86191732-86191754 GACCCCTGCCCTATGAACTTGGG + Intergenic
1046849093 8:118952399-118952421 GCTGCCTGACCCCTTCACTTCGG + Intergenic
1047770784 8:128028271-128028293 GCTCCCAGGCCCATTCACATGGG + Intergenic
1048801284 8:138196459-138196481 GATCCCTGCCACACTCTCTCCGG - Intronic
1048831439 8:138481527-138481549 GATGGCTGCACCATTCCCTTAGG + Intronic
1051587983 9:18747365-18747387 GATCCGAGCCTCATTCACTGAGG - Intronic
1053538853 9:38952637-38952659 GAGCCCTGCCCCATTCCCAGGGG - Intergenic
1054627287 9:67411282-67411304 GAGCCCTGCCCCATTCCCAGGGG + Intergenic
1056073227 9:83010738-83010760 TATCCCTGCCCCACTCACACCGG + Intronic
1056560699 9:87726670-87726692 GCTCCCTCCTTCATTCACTTGGG - Intronic
1061565949 9:131440004-131440026 GATCCCAGCCCCAGCTACTTGGG - Intronic
1186526648 X:10255285-10255307 GCTCCCTGCCCCATTTGATTAGG + Intergenic
1186692869 X:11997778-11997800 CTTCCCTGCCCCATTGATTTGGG - Intergenic
1189287432 X:39861458-39861480 AATCCCTGCCCCAATCCCTTGGG + Intergenic
1189339074 X:40190842-40190864 TCTCCCTGACCCATTGACTTTGG - Intergenic
1190316933 X:49157166-49157188 GCCCCCTGCCACCTTCACTTGGG + Intergenic
1190317830 X:49163053-49163075 GCCCCCTGCCACCTTCACTTGGG - Intronic
1192150916 X:68711928-68711950 GGTCCCAGCCCCATTCATCTTGG + Intronic
1197743776 X:129916439-129916461 ACTCCCTACCCCAGTCACTTAGG + Intronic