ID: 1158670494

View in Genome Browser
Species Human (GRCh38)
Location 18:59469659-59469681
Sequence GTCCTTTCCAGGCCAGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 274}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158670494_1158670501 -10 Left 1158670494 18:59469659-59469681 CCTGGCCCTGGCCTGGAAAGGAC 0: 1
1: 0
2: 4
3: 31
4: 274
Right 1158670501 18:59469672-59469694 TGGAAAGGACTTTCTGGGCTGGG 0: 1
1: 1
2: 2
3: 32
4: 318
1158670494_1158670504 19 Left 1158670494 18:59469659-59469681 CCTGGCCCTGGCCTGGAAAGGAC 0: 1
1: 0
2: 4
3: 31
4: 274
Right 1158670504 18:59469701-59469723 TCAAGGGCACGTGTGAAGTGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
1158670494_1158670503 3 Left 1158670494 18:59469659-59469681 CCTGGCCCTGGCCTGGAAAGGAC 0: 1
1: 0
2: 4
3: 31
4: 274
Right 1158670503 18:59469685-59469707 CTGGGCTGGGCTCTGCTCAAGGG 0: 1
1: 1
2: 5
3: 46
4: 366
1158670494_1158670502 2 Left 1158670494 18:59469659-59469681 CCTGGCCCTGGCCTGGAAAGGAC 0: 1
1: 0
2: 4
3: 31
4: 274
Right 1158670502 18:59469684-59469706 TCTGGGCTGGGCTCTGCTCAAGG 0: 1
1: 0
2: 4
3: 56
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158670494 Original CRISPR GTCCTTTCCAGGCCAGGGCC AGG (reversed) Intronic
900679820 1:3910622-3910644 GTCCATGCCAGGCCAAAGCCAGG - Intergenic
900991452 1:6100153-6100175 GTCCTGGCCGGGCCAAGGCCTGG + Exonic
902408363 1:16198786-16198808 TTCCCTTCCAGGCCTGGCCCTGG - Intronic
902799667 1:18821379-18821401 TTCCTGTCCAGGGCAAGGCCTGG - Intergenic
903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG + Intronic
903778177 1:25806355-25806377 GGGCTCTCCAGGCCAGGGACGGG + Intronic
904540637 1:31230602-31230624 TCCCTCTCCAGGCCAGGGCAGGG + Intronic
905328960 1:37178823-37178845 TTCCTTTCCAGGAAATGGCCAGG + Intergenic
906680826 1:47724662-47724684 GTCCTTGCCTGTCCAGGGCCAGG + Intergenic
907664022 1:56418434-56418456 GTCTTCTCCAGGCTTGGGCCAGG - Intergenic
908320376 1:62972673-62972695 GACAGTTCAAGGCCAGGGCCAGG - Intergenic
909561594 1:77014470-77014492 GCCTTTTCCTGGGCAGGGCCTGG - Intronic
910507029 1:87961093-87961115 GCACCATCCAGGCCAGGGCCTGG - Intergenic
913201841 1:116501129-116501151 GAGCTTTCCAGGCCAAGGACGGG - Intergenic
915459183 1:156059580-156059602 TTCCTTGACAGCCCAGGGCCTGG - Intergenic
917474390 1:175355752-175355774 CTCCTTTCCAAGCCAGAGCAGGG - Intronic
919814948 1:201431365-201431387 GTCCTATCCTGGCTAGGGTCTGG - Intergenic
920843894 1:209577479-209577501 GGCCTTTCCAGGCCACATCCTGG + Intergenic
922151718 1:223011342-223011364 GTCCTTTCCAGGGCAGGGCAAGG - Intergenic
922217751 1:223534385-223534407 GGCCTTTCCAGCCCAGGGAATGG + Intergenic
922420072 1:225453710-225453732 CTCCTGTCAAGGGCAGGGCCAGG - Intergenic
924383692 1:243484338-243484360 GTGCTTTTCTGGCCAGGGCCAGG - Intronic
924934347 1:248755605-248755627 GTCCTTCCCCGGCCAAGTCCAGG - Intronic
1062779084 10:184996-185018 TTCCTTTCCAGGACAAAGCCCGG - Intronic
1064981319 10:21170323-21170345 ATTCTTTACAGGGCAGGGCCAGG - Intronic
1067062919 10:43087196-43087218 GTGCCTCCCAGGCCAGGGCCGGG + Intronic
1067523259 10:47023481-47023503 GTCCTCTCCAGGCCACAGCCTGG + Intergenic
1067723411 10:48747972-48747994 GCCCTTTCCAAGCCAGGCCTTGG + Intronic
1067839322 10:49663463-49663485 GCCCTGTCCATGCCAGGCCCTGG - Intronic
1069750794 10:70743968-70743990 GTCTTCTCCTGACCAGGGCCTGG + Intronic
1069899105 10:71696807-71696829 ATTCCTTCCAGCCCAGGGCCAGG + Intronic
1070781999 10:79143104-79143126 GCCCCCTCCAGGCCAGGCCCCGG + Intronic
1072038880 10:91589356-91589378 GTCCTGCCCTTGCCAGGGCCTGG - Intergenic
1072135467 10:92541767-92541789 GTCCTTTGCAGTTCAGGGACTGG + Intronic
1073070670 10:100791235-100791257 GGCCTTTCCAGGACTGGGGCTGG + Intronic
1073106387 10:101034747-101034769 GTACTTTCCTGGGCAGAGCCCGG + Exonic
1073441230 10:103553858-103553880 CTGGTGTCCAGGCCAGGGCCAGG + Intronic
1074400405 10:113136979-113137001 GTCCCTTCCAGATCAGGGCAAGG - Intronic
1075130438 10:119733661-119733683 AGCCTTTGCTGGCCAGGGCCTGG - Intronic
1075484917 10:122814191-122814213 GTCCATGGGAGGCCAGGGCCGGG + Intergenic
1075487754 10:122839727-122839749 GTCCTGTCCAGTGCAGGGCATGG - Intronic
1075707786 10:124512181-124512203 GGCCTTCGCAGGCCAGTGCCAGG - Intronic
1075742398 10:124703902-124703924 TTCCTTCCCTGGCCAGGGCTGGG + Intronic
1075929968 10:126287715-126287737 GTGATGTCCAGGCCAGTGCCTGG - Intronic
1077110705 11:860835-860857 GTCCTGTCCAGTCCAGGGTGGGG + Intronic
1077192402 11:1260911-1260933 CTCCTAGCCAGGCCAGGGCCCGG + Intronic
1077236470 11:1484295-1484317 GTATTTTCCAGGCCTGGGCTTGG - Intronic
1077263206 11:1634240-1634262 GTGCTTCCCAGTCCAGGGCTAGG + Intergenic
1077412884 11:2411596-2411618 GTCCCTCCAGGGCCAGGGCCAGG + Intronic
1080048063 11:27830303-27830325 GTCCTTTGCAGGCCATGTCAAGG - Intergenic
1081850847 11:46274197-46274219 GCCCTTTCCAGGACAGGGCCTGG - Intergenic
1082986421 11:59173728-59173750 TGCCTTTCCAGGTCAGAGCCAGG + Intronic
1083743058 11:64721345-64721367 GTTCTTTCCAGCCCAGGCCTGGG - Intronic
1084674001 11:70623900-70623922 GCCCCTCCCAGGCCAGGGCAGGG + Intronic
1085783251 11:79428606-79428628 GACATCTCCAGGCAAGGGCCAGG + Intronic
1089502265 11:118939715-118939737 GTCCTCCCCAGGCCAGGCCAAGG + Intronic
1089635059 11:119806759-119806781 GTCCTGGGCAGGCCAGGGCGGGG + Intergenic
1090075043 11:123575255-123575277 CTCCTTTCCATTCCAGGGTCTGG + Intronic
1091148444 11:133302206-133302228 CTCATTTCCAGGGCAGGACCAGG + Intronic
1091787580 12:3252355-3252377 GCCCATTCCAGGCCAGGGAATGG + Intronic
1096182642 12:49559129-49559151 GTCCTTTCTAGCCCTGGGCTTGG - Intronic
1097036820 12:56129589-56129611 CCCCTTTCCAGTCCAGGGCCTGG - Intronic
1101655039 12:106712620-106712642 GTGCTGTCCATGCCAGGGGCAGG - Intronic
1102128076 12:110501906-110501928 GCCTTTCCCAGGCCAGCGCCTGG + Intronic
1102799531 12:115719408-115719430 CTCCTCTCCAGGCCTGTGCCAGG - Intergenic
1103725842 12:122997018-122997040 GACCCTTCCCGGCCAGGGCCTGG + Intronic
1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG + Intergenic
1106110050 13:26768951-26768973 GTCCTTCACAAGCCAGGGCAGGG - Intergenic
1109432904 13:62258794-62258816 GTTGTTTCCAGCCCAGGGCAAGG - Intergenic
1110369954 13:74728827-74728849 GTCCCTTCCAGCCCAGTGTCTGG + Intergenic
1112184512 13:97114955-97114977 GGCCTTTTCAGGCAAGGGCAGGG + Intergenic
1113338807 13:109402343-109402365 GTCCTTTCATCCCCAGGGCCTGG - Intergenic
1113950022 13:114066576-114066598 GTCCCTTCCAGGCCTGGGCCTGG + Intronic
1113961340 13:114127978-114128000 CCCCTTTCCAGGCAAGGCCCGGG + Intronic
1116948551 14:50858128-50858150 GTCCTTTCCTGGCCAATGCTTGG + Intronic
1117611283 14:57485661-57485683 GTGCTCTCCAGTCCAGGACCAGG - Intronic
1118359844 14:65046375-65046397 GTCTTATCCATGCCAGGGACAGG - Intronic
1118763317 14:68893909-68893931 CTCCTTGCCAGCCCATGGCCAGG + Intronic
1119624840 14:76164098-76164120 TTCCTTGCCAGGGCTGGGCCAGG - Intronic
1121584560 14:95054481-95054503 GGTCATCCCAGGCCAGGGCCTGG + Intergenic
1122232937 14:100316135-100316157 GCCCTCTCCAGAGCAGGGCCTGG - Intergenic
1122348180 14:101073213-101073235 GCCCGTTCCAGGCCTGGGGCTGG + Intergenic
1122475809 14:102008167-102008189 CTCCTTTCCAGGCAATGGGCCGG + Exonic
1122923910 14:104891214-104891236 GCCCTCTCCAGGCCAGGCGCTGG + Intronic
1123017928 14:105384411-105384433 GGTCTCTCCAGGCCAGGTCCTGG - Exonic
1123024432 14:105418060-105418082 CTCCTCTCCAGGCTGGGGCCAGG + Intronic
1123064038 14:105607155-105607177 GGCCATTCCAGGCCTGGGGCAGG - Intergenic
1123073352 14:105652798-105652820 GGCCATTCCAGGCCTGGGGCAGG - Intergenic
1123093277 14:105751565-105751587 GGCCATTCCAGGCCTGGGGCAGG - Intergenic
1123113289 14:105882745-105882767 GTCCTCCCCAGGGCAGGGCCAGG + Intergenic
1123402618 15:20003180-20003202 GTCCACCCCAGGGCAGGGCCAGG + Intergenic
1123511957 15:21009834-21009856 GTCCACCCCAGGGCAGGGCCAGG + Intergenic
1125729732 15:41886395-41886417 GTCCTTCTCAGGGCAGGCCCTGG + Intronic
1126712981 15:51482630-51482652 GTCATTTCCAGGTCTGGGGCAGG + Intronic
1128138395 15:65281349-65281371 GTACTTCCCAGGCCAGGCACTGG + Intronic
1128161176 15:65423414-65423436 GTCCATTCCAGCCCAGGTCCTGG + Intergenic
1128233811 15:66053666-66053688 CTCCATTCCCAGCCAGGGCCAGG + Intronic
1128509564 15:68305058-68305080 GGGCCTTGCAGGCCAGGGCCAGG - Intronic
1128511057 15:68314118-68314140 GTCCGTGCCAGGCCAGGCACAGG - Intronic
1128758062 15:70196523-70196545 GTGGATTCCAGGCCAGGCCCGGG - Intergenic
1129162442 15:73753981-73754003 GTGCAGTTCAGGCCAGGGCCTGG + Intergenic
1130105997 15:80928923-80928945 GCCCTTACCTGGCCAGGGTCAGG - Exonic
1130297155 15:82655541-82655563 TTCCTTTCCAAGCCAGGACAGGG + Intergenic
1131351609 15:91705881-91705903 TACCTTTCCAGGGGAGGGCCAGG - Intergenic
1131832204 15:96361163-96361185 GTCCTTTCCCGGCTAAGGGCGGG - Intergenic
1136579001 16:31140809-31140831 GTCCTTCCCAGCCCAGGGGAAGG + Intronic
1136651950 16:31680613-31680635 GTCCCTTCCAGGCCAGTCCTTGG + Intergenic
1138628978 16:58278466-58278488 GTCCTTCCCAACCCAGGACCGGG + Exonic
1139449513 16:67018353-67018375 GTCCTTTCCAGGCCATGCCCTGG + Intergenic
1139477396 16:67209580-67209602 GTCATTTCCTAGCCAAGGCCAGG - Intronic
1139507538 16:67406645-67406667 GTCCTGGCCAGTCTAGGGCCAGG - Intronic
1139967124 16:70751854-70751876 CCCTTTCCCAGGCCAGGGCCAGG - Intronic
1140213651 16:72990273-72990295 GGCATTTACAGGCCAGGACCTGG - Intronic
1140411777 16:74745415-74745437 GGCCTCTCCAGGCCTGGGGCAGG - Intronic
1141102535 16:81208590-81208612 GTGCTTCCCAGGCCAGTGCCAGG - Intergenic
1141128187 16:81416087-81416109 GCCATTTCCAGGCCAGGGAATGG - Intergenic
1203147036 16_KI270728v1_random:1809102-1809124 GTCATTTCAGGGTCAGGGCCAGG + Intergenic
1143039724 17:4024936-4024958 ATCCTTTCAGGGCCAGGGACAGG + Exonic
1143106341 17:4532324-4532346 GGCCTGTCCAGACCAGGGGCAGG - Intronic
1144457487 17:15430945-15430967 GTCCTCTCCAGACCTGGGGCAGG - Intergenic
1144760265 17:17703237-17703259 TTCCTGTCCAGGTCAGGGTCAGG + Intronic
1145270178 17:21400624-21400646 GTCCTTTCCCGACAAGGCCCTGG + Intronic
1145308407 17:21688075-21688097 GTCCTTTCCCGACAAGGCCCTGG + Intergenic
1146131221 17:30277588-30277610 CTCCTTTTTTGGCCAGGGCCTGG - Intronic
1146290645 17:31604609-31604631 GTCCTCTCCCTTCCAGGGCCAGG + Intergenic
1146631440 17:34473145-34473167 GACCTGCCCAGGCCAGGGCAGGG - Intergenic
1147720677 17:42537503-42537525 GGCCGCTCCAGGCCAGTGCCAGG - Exonic
1148151587 17:45399640-45399662 GTCCTTTGCAGGGGAGGGCTAGG - Intronic
1148669780 17:49402080-49402102 GTCCTGTCCTGGCCAGGGAAGGG - Intronic
1150008811 17:61486600-61486622 GTGCTCTCCAGCCCAGGGCCAGG + Intergenic
1151786834 17:76279227-76279249 CTCCCTTCCAGGCCGGGGGCGGG - Intronic
1151812439 17:76452655-76452677 GTCCTTCCCTGGCCTCGGCCCGG + Intronic
1152153501 17:78617665-78617687 GTCCTTTTCAGGCCTAAGCCAGG - Intergenic
1152225642 17:79091388-79091410 GTCCTTTCCTGGCACTGGCCTGG - Intronic
1152642213 17:81453996-81454018 GGCCACGCCAGGCCAGGGCCAGG + Intronic
1152656163 17:81520060-81520082 GGCCTTCCCAGGGCTGGGCCAGG + Intronic
1152739415 17:82012487-82012509 GTCCTTTCCCACCCGGGGCCAGG - Intronic
1154106828 18:11530893-11530915 GTCCTTCGCAGGCCACGGCAGGG - Intergenic
1154176543 18:12089488-12089510 GTCAATGCCAGGCCAAGGCCAGG - Intergenic
1156213879 18:34977144-34977166 GTCCCTCCCAGGCCAGGGGCTGG + Intronic
1158142198 18:54267815-54267837 GTTCTTAACAGGCCAGGGACTGG - Intergenic
1158670494 18:59469659-59469681 GTCCTTTCCAGGCCAGGGCCAGG - Intronic
1159014222 18:63088518-63088540 GTCCAGCCCAGGCCAGAGCCAGG + Intergenic
1160255362 18:77243682-77243704 GTCCTTCCCTGGCCAGTGCCTGG + Intergenic
1161684179 19:5694992-5695014 CTCGTTCCCAGGCCAGGGTCTGG - Intronic
1161998481 19:7729196-7729218 GCCCTGTCCAGCCCAGTGCCTGG - Exonic
1162140014 19:8580184-8580206 GTCCTTTCCAGACCTGGGTGGGG + Intergenic
1162312452 19:9914910-9914932 GGCCTTTCCAGGCGGCGGCCTGG + Intronic
1162781134 19:13007511-13007533 GCCCTTGCCATGCCAGGGCCTGG - Intronic
1162786175 19:13036377-13036399 GTCCTCTCCAGGCCAGGGGTGGG + Intronic
1163514322 19:17754035-17754057 GTCCTTTCCTGGGGAGGCCCCGG + Intronic
1163580748 19:18137273-18137295 GCCCTGCCCAGTCCAGGGCCAGG - Exonic
1165068219 19:33241122-33241144 CTCCCTTCCGGGCCAGGGCCAGG - Intergenic
1165248743 19:34513481-34513503 GCACTTTCTATGCCAGGGCCAGG + Intergenic
1165259013 19:34597331-34597353 GCACTTTCTATGCCAGGGCCAGG + Intronic
1166382769 19:42363280-42363302 GACCGTGCCAGGCAAGGGCCCGG + Intronic
1168585028 19:57584860-57584882 TTCCTGTCCAGGCCAGAGCCAGG - Intronic
925279443 2:2672413-2672435 GTGATTACCAGGCCACGGCCAGG - Intergenic
925440120 2:3878463-3878485 GGCCTCTCCAGGGCAGGGGCAGG - Intergenic
927150467 2:20192543-20192565 GCCCTTTCGAGGACAGAGCCTGG - Intergenic
928821740 2:35369925-35369947 TTTTTTTCCAGGCAAGGGCCTGG + Intergenic
929287328 2:40150096-40150118 CTCCTTTCCAGCTCGGGGCCAGG + Intronic
929657500 2:43748711-43748733 GTCTTTGGCAGGCCAGGTCCAGG - Intronic
931705422 2:64942823-64942845 GCTCTTTCCAGGCCAGGGGAAGG + Intergenic
932479787 2:72032348-72032370 GTGAATTCCAGGCCAGGGCAGGG + Intergenic
933819214 2:86094591-86094613 GCCCTTTCAGGGACAGGGCCAGG + Intronic
937234356 2:120421571-120421593 GTCCTTGCCAGGCCGGAACCTGG + Intergenic
937265833 2:120614123-120614145 TTCCCTTCCAGCCCGGGGCCTGG - Intergenic
937305974 2:120871122-120871144 TTCTTCTCCAGGCCAGAGCCTGG + Intronic
937701040 2:124863315-124863337 GGCCTTTCCCTGCCAGGGGCAGG + Intronic
937879282 2:126852858-126852880 GCTCTGTCCAGGCCAAGGCCTGG + Intergenic
937882412 2:126878285-126878307 GTCCTCTCCAGGCCAGGTCTGGG + Intergenic
938159452 2:128972669-128972691 GTCCACTCAAGGCCAGGGCCAGG - Intergenic
941368596 2:164636712-164636734 ATCATTTCGAGGCCAAGGCCAGG + Intergenic
946280241 2:218661071-218661093 CACCCTTCCGGGCCAGGGCCAGG - Exonic
947622076 2:231597290-231597312 GGCCAGGCCAGGCCAGGGCCAGG + Intergenic
947911452 2:233803507-233803529 GGCCTTGCCAGGCCAGGGCATGG - Intronic
948020971 2:234732908-234732930 GTCTTTTCCAGGCTAGGGAGGGG - Intergenic
948510700 2:238462457-238462479 GTTCTGTCCCTGCCAGGGCCCGG + Intergenic
948865500 2:240772852-240772874 GTACCATCCAGGCCAAGGCCAGG + Intronic
1170697406 20:18671763-18671785 GTCCTCACCAGACCTGGGCCTGG + Intronic
1171484570 20:25477622-25477644 GTCCATGCCTGGCCAGGGCAAGG + Intronic
1171965109 20:31523921-31523943 CTCCCTTCCAGCCCAGAGCCTGG + Intronic
1172119496 20:32589463-32589485 GGCCTGTCCACGCAAGGGCCAGG + Intronic
1173080733 20:39864588-39864610 AACCCTTCTAGGCCAGGGCCAGG - Intergenic
1174085946 20:48007120-48007142 GTCCCTTCCAGGCCCAGTCCAGG + Intergenic
1174274186 20:49391670-49391692 GGTCTCTCCAGGCCAGGCCCAGG - Intronic
1174281943 20:49445805-49445827 GTCCTTTCCCTGCCAGAGCAGGG - Intronic
1174699300 20:52591272-52591294 GTGCTTTCAAGGCCATGGACGGG - Intergenic
1175445835 20:59018854-59018876 GCCCTATCCATGCCAGGGCTGGG - Intergenic
1175965378 20:62657612-62657634 CTCCTTCCCAGGCAAGTGCCAGG - Intronic
1176857877 21:13985925-13985947 GTCACTTCAGGGCCAGGGCCAGG - Intergenic
1176866714 21:14058270-14058292 GTCACTTCAGGGCCAGGGCCAGG + Intergenic
1179114917 21:38482109-38482131 GTCCCTTCCAGGCCATGGATGGG - Intronic
1182060974 22:27397135-27397157 GTCCTTCCCAGGGCTGGGACAGG + Intergenic
1183199121 22:36373647-36373669 GCCCCCTCCAGGACAGGGCCTGG + Intronic
1183392262 22:37552330-37552352 GTGCTCTCCAGACCTGGGCCAGG - Intergenic
1183736604 22:39648120-39648142 GGGCTTTCCAGAGCAGGGCCTGG - Intronic
1183989575 22:41589210-41589232 GACCTTTGCAGGCCTGGGACTGG - Intronic
1183990993 22:41597020-41597042 GTACCTCCCAGGGCAGGGCCTGG - Intergenic
1184272595 22:43393262-43393284 GCCCTTTCCCAGCCTGGGCCGGG + Intergenic
950776681 3:15356325-15356347 CTCCTCTCCAGCCCAGGCCCTGG - Intergenic
952451467 3:33437751-33437773 GTACTTTCCATGCCTGGCCCTGG - Intronic
954544434 3:51420686-51420708 GGGCTTTGCAGGCCAGGGCCCGG + Exonic
954904227 3:54046030-54046052 GTCCTTTGCAAGCCTGTGCCTGG - Intergenic
960541930 3:118871221-118871243 TGGCTTTCCAGGCCAGGCCCAGG + Intergenic
961337999 3:126196180-126196202 GTCCTTGGAAGGACAGGGCCAGG + Intronic
961374539 3:126455496-126455518 GTCGATTCCAGGGCAGGGACAGG + Intronic
961410975 3:126720186-126720208 GTCTTTTGCATGACAGGGCCTGG + Intronic
961565988 3:127763633-127763655 GTCCACTCCAGGCCAGGTCAGGG - Intronic
961603704 3:128078388-128078410 GTGGTTTCCCTGCCAGGGCCAGG + Intronic
962259800 3:133895299-133895321 GGCCTTTCCGAGCCTGGGCCGGG + Intronic
962264564 3:133935719-133935741 GTCATCTCAAGCCCAGGGCCTGG + Intronic
962345168 3:134613392-134613414 CTCCTTTCCAGGGCTGGGGCAGG - Intronic
962481577 3:135802788-135802810 GTTCTTTCCAAGCCTGGCCCTGG - Intergenic
964716964 3:159732651-159732673 GGCATTTCCAGGGCAGGGCAGGG + Intronic
965722537 3:171677618-171677640 GTCCTTTCCATGCCAGAATCTGG + Exonic
968299069 3:197599516-197599538 GTCTTTCCCAGCCCAGCGCCAGG - Intergenic
968893072 4:3382384-3382406 GTCGCTTCCAGGCCACGGCTGGG - Intronic
969577360 4:8044211-8044233 GTCCCCGCCAGGCCAGGACCTGG - Intronic
970609109 4:17709212-17709234 GTCGGAGCCAGGCCAGGGCCCGG - Exonic
971942896 4:33238472-33238494 TCTCTTTCCAGGCCAGGGCCTGG + Intergenic
975604555 4:76141021-76141043 GTCCTTTCCAAGCCAAAGCATGG - Intronic
978359311 4:107911455-107911477 TTTCTTTCCAGGTCAGGCCCTGG + Exonic
980093682 4:128467806-128467828 ATCCTTTCTATGCCAGGCCCTGG + Intergenic
980819594 4:137995862-137995884 GACCTTTCCAGGGCCGGGCCTGG - Intergenic
981706960 4:147669885-147669907 GTCCTGTCCAAGCCATAGCCTGG + Intronic
985639689 5:1057876-1057898 GGCCTTTCCAGTTCAGGGCCAGG - Intronic
986666813 5:10111825-10111847 TTCCTTACCAGGCCAGGCTCAGG - Intergenic
989712897 5:44422460-44422482 GGCCTATCCAGCCCAAGGCCAGG + Intergenic
992609864 5:78498003-78498025 CTCCTCTCCTGGCCAGTGCCTGG - Intronic
996727542 5:126685741-126685763 GTCCTTTCTAGGCCAGGTTGTGG + Intergenic
998529889 5:142874802-142874824 GCCCCTTCCAGCCCGGGGCCTGG + Intronic
1001083740 5:168685654-168685676 GTCCTTCCAAGGGCAGGGCAGGG + Intronic
1001491887 5:172161880-172161902 GTCCCTTGCAGGCCAGAGCCTGG + Intronic
1001772020 5:174303839-174303861 GTCCTGTTCTGGCCAGGGTCTGG + Intergenic
1001939575 5:175731029-175731051 GTGCTCTCCAGGCCAGGCCAGGG - Intergenic
1002212676 5:177608083-177608105 CTCCTCTCCAGGCCATGGCAGGG + Intronic
1002436630 5:179235642-179235664 TTCCTCTCCAGGGCAAGGCCTGG - Intronic
1002571375 5:180141202-180141224 GACCTTTCCATGGCAGGGCAGGG + Intronic
1004037704 6:11939909-11939931 GTCACTTCCAGGCCAAGGCATGG + Intergenic
1005430460 6:25751389-25751411 ATTCTTTCCAGGGCAGGGCCAGG - Intergenic
1005743415 6:28814110-28814132 GTCCTTACCCTGCCAGCGCCTGG + Intergenic
1005840852 6:29743816-29743838 GTCCTGCCCAAGCCAGGGCTGGG - Intergenic
1005850194 6:29815035-29815057 GTCCTGCCCAAGCCAGGGCTGGG - Intergenic
1005922868 6:30416807-30416829 GTCCTGCCCAAGCCAGGGCCGGG + Intergenic
1006072517 6:31507702-31507724 GTGCTTCCCAAGCCAGGGCTGGG + Intronic
1006276789 6:33010543-33010565 AGCCTTTCCAAGGCAGGGCCAGG + Intergenic
1007253908 6:40515456-40515478 GCCCTTTCCATGACAGTGCCTGG + Intronic
1007396717 6:41582197-41582219 GTCCCTTCCGGGTCAGGGTCAGG + Intronic
1007607208 6:43125576-43125598 CTCCTTCCCTGGCCAGGGTCTGG + Intronic
1009619998 6:66063566-66063588 GCCCCTTTCATGCCAGGGCCAGG + Intergenic
1016881127 6:148913215-148913237 GTGCTGTCCTGGCCAGGGACGGG - Intronic
1016925525 6:149342700-149342722 TTCTTTTCCAGGGCAGGTCCAGG - Exonic
1017092768 6:150775866-150775888 GACTTTTCCAGGCCAGTGCCTGG + Intronic
1018040102 6:159914554-159914576 GTTGTTTCCAGGCCAGGGGAGGG + Exonic
1018796020 6:167186245-167186267 GTCCTTCCAAGGCCTGTGCCAGG - Intronic
1018820299 6:167368819-167368841 GTCCTTCCAAGGCCTGTGCCAGG + Intronic
1018826943 6:167415576-167415598 GGCCTTCCCAGGCCCGGTCCAGG + Intergenic
1019331891 7:464415-464437 GTACTTTCCAGGGCAGGGTGGGG - Intergenic
1020799759 7:12719152-12719174 GACTTTTCCAGGCCAGGGGCTGG - Intergenic
1024117638 7:46208832-46208854 GTCCTTCCCAGGCAGGGGCTGGG - Intergenic
1025144144 7:56490445-56490467 GTCTCTTCCAGGCCAGGTCTTGG + Intergenic
1026413739 7:70155929-70155951 GTCCTTTCCAAGCCAGAAACTGG - Intronic
1026628411 7:72016801-72016823 GTTCTTCCCAGCCCAGGCCCAGG - Intronic
1026654474 7:72245207-72245229 GTCCTTACCAGGGCGGGGCTGGG - Intronic
1027051551 7:75024552-75024574 GACCCCTCCAGGGCAGGGCCGGG + Intronic
1027495150 7:78878882-78878904 GCCCTCTCCATGCCATGGCCAGG + Intronic
1028834382 7:95358117-95358139 GTCCTTTCCCTGGGAGGGCCTGG - Intergenic
1029234105 7:99098887-99098909 ATCATTTCCATTCCAGGGCCTGG - Intronic
1030240437 7:107317219-107317241 GGACTTTCCAGGCCATGGCACGG + Intronic
1031986847 7:128168851-128168873 GGGCGTTCCAGGCCAGGGCAAGG - Intergenic
1032078951 7:128849182-128849204 GTCCATTGGAGGCCATGGCCTGG + Exonic
1032697612 7:134350899-134350921 TTCCTTTGAAGGACAGGGCCCGG + Intergenic
1034419217 7:150980149-150980171 CTCCTGTCCAGGCCAGGGGATGG + Intergenic
1034637403 7:152578140-152578162 GTCATTTCTGGGCCTGGGCCAGG - Intergenic
1035727425 8:1833643-1833665 CCCCTTTCCATGCCAGGCCCCGG + Intronic
1037829091 8:22177652-22177674 GTCCTGTCCAGCAGAGGGCCTGG - Intronic
1039482108 8:37881865-37881887 GACAATTCCAGGCCAGGCCCTGG - Intronic
1039804248 8:40984980-40985002 GTCCTCTCCTGGCCAGGCCTGGG - Intergenic
1039904232 8:41774490-41774512 GTGCTTCCCATCCCAGGGCCAGG + Intronic
1039967593 8:42294453-42294475 GTCTTCTCTAAGCCAGGGCCTGG + Intronic
1045111376 8:98941310-98941332 GTCCTTGCTACTCCAGGGCCAGG + Intronic
1048463617 8:134643417-134643439 GTACTTTCCAGCCCAGGGAGTGG - Intronic
1049005082 8:139849913-139849935 CTCCTGTCCAGGAGAGGGCCTGG + Intronic
1049311021 8:141933947-141933969 GGCCTTTCCAAGCCAGCTCCGGG + Intergenic
1049323626 8:142010583-142010605 CCCCTGTCCAGGCCTGGGCCGGG + Intergenic
1049529739 8:143148302-143148324 GCCCTCCCCAGGCCAGGTCCTGG + Intergenic
1049592480 8:143468898-143468920 CTCCTCTCCAGGGCAGGGTCCGG + Intronic
1052915711 9:33923150-33923172 CTCCTTTCCAGGATAAGGCCTGG - Intronic
1056625381 9:88248911-88248933 GTCCTTCCCCATCCAGGGCCAGG + Intergenic
1057354987 9:94325363-94325385 CTCCCTCCCAGGCCAAGGCCCGG - Exonic
1057367072 9:94432689-94432711 GTACTTTCCAGGACACAGCCTGG + Intronic
1057652765 9:96932271-96932293 CTCCCTCCCAGGCCAAGGCCCGG + Exonic
1057656263 9:96955381-96955403 GTACTTTCCAGGACACAGCCTGG - Intronic
1059299166 9:113298747-113298769 TTCCTTGCCAGGCCAAGGACTGG - Exonic
1060103011 9:120856741-120856763 GTCCATTTCAGGGCAGGGCAAGG + Exonic
1060517606 9:124275740-124275762 GCCTTTGCCAGGCCAGGCCCTGG - Intronic
1061622967 9:131823733-131823755 GTCATTTCCAGACCTGGGACAGG - Intergenic
1062302507 9:135882884-135882906 TCCCTTTCCGGGACAGGGCCTGG + Exonic
1062529578 9:136993998-136994020 TCCCTTCCCAGGCCAGTGCCAGG - Intergenic
1189344735 X:40232432-40232454 GTCCTGTCCAGGGCAGGGGGTGG + Intergenic
1189810514 X:44776825-44776847 GCCATTTCCAGCCCAGGCCCTGG + Intergenic
1190079656 X:47346369-47346391 GTCCTAACCATGCCAGGGGCAGG + Intergenic
1191847891 X:65562286-65562308 ATCCTTTCCTGGCCAGGCCCTGG - Intergenic
1193539788 X:82757327-82757349 GTCCTTTCACAGCCAGGGCTGGG + Intergenic
1200066053 X:153504555-153504577 GTCTTCTCCATGCCAGGGGCTGG - Intronic
1200078692 X:153564967-153564989 GTCCTTCCCGGGCCCGTGCCCGG - Exonic
1200892425 Y:8338056-8338078 GTCCTCTCTAGGCAAGGGCTAGG - Intergenic
1201190201 Y:11438180-11438202 GTCCTGCCCAGGCCCTGGCCCGG + Intergenic