ID: 1158671196

View in Genome Browser
Species Human (GRCh38)
Location 18:59475509-59475531
Sequence CAGAATAAACAAAAGTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 523}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158671196 Original CRISPR CAGAATAAACAAAAGTATGG AGG (reversed) Intronic
901253737 1:7802687-7802709 CAACATAAACATAATTATGGAGG + Intronic
901508769 1:9703547-9703569 CAGAATTAATAAATCTATGGTGG - Intronic
902801523 1:18832978-18833000 CAGAAAAAAAAAAAGAGTGGGGG - Intergenic
903185895 1:21628887-21628909 CAGAAAAAAAAAAAGGAGGGGGG + Intronic
903381892 1:22902963-22902985 CAACATGAACAAAAGCATGGAGG + Intronic
905073846 1:35252065-35252087 CAGAAAAAAAAAATGTTTGGTGG + Intergenic
905530979 1:38678500-38678522 CAGCATGAACAAAAGTCTGGGGG - Intergenic
905575733 1:39043177-39043199 CAGTATGAGCAAAAGCATGGAGG + Intergenic
906016478 1:42586159-42586181 CTAAATAGACAATAGTATGGAGG + Intronic
906587006 1:46987160-46987182 CAAAATAAATAAAGGGATGGAGG + Intergenic
907718472 1:56950029-56950051 CAGCTTAAGCAAAAGCATGGAGG + Intronic
908585691 1:65564968-65564990 TAGAATAATTAAAAGTCTGGTGG - Intronic
909228240 1:73053193-73053215 CATCATAGACAATAGTATGGGGG + Intergenic
909374393 1:74923686-74923708 CAGAATGAAGAAAAGCAGGGTGG + Intergenic
909620341 1:77660200-77660222 CACAATAAAAAAAAATATTGGGG - Intronic
910102631 1:83594715-83594737 CATAAGAATCAAAAGTAAGGTGG - Intergenic
911149211 1:94580679-94580701 GAGAATAAAGAAAACTAGGGTGG - Intergenic
911506912 1:98764146-98764168 CAGAAGAAAGAAAAGTACTGGGG + Intergenic
911828184 1:102514915-102514937 CACTATAAAAAACAGTATGGAGG + Intergenic
912461981 1:109840784-109840806 CAGAATAGACACATTTATGGAGG + Intergenic
914731267 1:150372769-150372791 CAGAAAAAACAAAAGTCCTGAGG + Intronic
914946699 1:152073194-152073216 CAGCATTAACAAAGGCATGGAGG - Intergenic
916172170 1:162009660-162009682 CTGAATAAACAAGAGGCTGGCGG + Intronic
916296362 1:163224612-163224634 CATTACAAACAACAGTATGGAGG - Intronic
916837351 1:168560824-168560846 CAGAATAGGCAAAACTATGGAGG + Intergenic
917247182 1:173016695-173016717 CAGAATGAACTAAAGTGTGGTGG + Intergenic
917382636 1:174430407-174430429 CAGAAAAAACAAAATCATGAGGG - Intronic
917560361 1:176146233-176146255 CAGATTAAACAAAAGGGTGTTGG - Intronic
917690962 1:177468598-177468620 CAGAACGAACAAAAGTACAGAGG + Intergenic
917955695 1:180095384-180095406 CAGAATAAAAAACAATATGGTGG - Intronic
918228347 1:182508098-182508120 CAGTATGAAAAATAGTATGGAGG - Intronic
918719758 1:187838282-187838304 CAGAATAGACAAGAGGATGGAGG + Intergenic
919325045 1:196097039-196097061 CAGAAAAAACAAAGGTGTGTGGG - Intergenic
919368137 1:196691832-196691854 TAGAATAAAGAATAGTATAGTGG - Intronic
919498597 1:198309248-198309270 CAGCATAAACAAAGATATAGGGG + Intronic
921315470 1:213886395-213886417 CAGCATAACCAAAAGTAAAGAGG + Intergenic
922181747 1:223241302-223241324 CAAAACTCACAAAAGTATGGAGG + Intronic
922919841 1:229293227-229293249 CAAAAAAACCAAAAGGATGGGGG - Intronic
923525925 1:234772721-234772743 CAGAATAAACAAAGAGATGCTGG - Intergenic
924738759 1:246782133-246782155 CAAAAAAAAAAAAAATATGGGGG + Intergenic
1062761368 10:23659-23681 CACTATAAACAACAGTTTGGAGG + Intergenic
1063922647 10:10947641-10947663 CAGAATAAAGAAATGTATGAGGG + Intergenic
1064420790 10:15189097-15189119 AAGAATAAATAAAAGAATGACGG - Intergenic
1064966750 10:21021880-21021902 CAGAAGAAACGAAGGGATGGAGG + Intronic
1065334453 10:24642033-24642055 CAGCATACACAAAAGTAGAGAGG + Intronic
1066366755 10:34784435-34784457 CAAAAAAAAAAAAAGTATGTTGG - Intronic
1067664770 10:48267934-48267956 CAGAATAAACAAATCCATAGAGG + Intronic
1070108509 10:73459986-73460008 AAAAATAAAGAAAAGTATGAGGG + Intronic
1070545238 10:77446872-77446894 CAGTGTGAACAAAGGTATGGAGG - Intronic
1070615635 10:77967502-77967524 CAGAAAAGACAAGAGTCTGGTGG - Intergenic
1071531910 10:86396309-86396331 CACTATGAACAACAGTATGGAGG + Intergenic
1071739650 10:88342757-88342779 CAGAATAGACAAAGGTCTCGAGG + Intronic
1072249632 10:93571425-93571447 TAGAATAAACAAAAGAATATGGG - Intronic
1072262090 10:93688295-93688317 CAGAAAAGGCAAAACTATGGAGG + Intronic
1073201037 10:101735780-101735802 CACAATAAACAAAAGCTTTGTGG - Intergenic
1073299770 10:102463880-102463902 CAGCATGAACAAAAGTGTGGAGG + Intronic
1073522463 10:104146393-104146415 CAGCATAAACAAAAATATTGGGG + Intronic
1073626572 10:105103646-105103668 CAGAAGAAAGAAAAGTTTAGAGG + Intronic
1074429644 10:113383106-113383128 CAGCATAAACAAATGAATGAAGG - Intergenic
1074443019 10:113495292-113495314 AGGAAAAAACAAAGGTATGGAGG - Intergenic
1075354436 10:121757867-121757889 CAGAATACACACAAATATGAGGG - Intronic
1076204371 10:128584336-128584358 CAGATGAAACAAATGTATTGAGG - Intergenic
1077622057 11:3734507-3734529 CAGAAGAAACAAATTTAGGGAGG + Intronic
1079663797 11:23077271-23077293 AAGAATAAACAAAAAGATTGAGG + Intergenic
1079680899 11:23296730-23296752 CAGAATAAAAAAACATTTGGAGG - Intergenic
1079736787 11:24007385-24007407 CAGAATAAACAAAAATTTGGAGG + Intergenic
1080940710 11:36914517-36914539 CAGCATAAACAAAGGTACAGAGG - Intergenic
1081212179 11:40349642-40349664 CACTATAAATAACAGTATGGAGG - Intronic
1081280069 11:41198620-41198642 GAGAGGAAAAAAAAGTATGGAGG + Intronic
1082259501 11:50067326-50067348 CTGAAGAAACTAAAGTAAGGTGG - Intergenic
1083677298 11:64333236-64333258 CAAAAAAAAAAAAAGTAGGGGGG - Intergenic
1084819692 11:71677299-71677321 TAAAATAAACAAAAATAGGGCGG + Intergenic
1085655578 11:78311690-78311712 ATGAATAAACAAATGCATGGAGG - Intronic
1085668556 11:78439455-78439477 CAGAACAAAGAAAAGAAAGGGGG + Intronic
1086342859 11:85865029-85865051 TAGAGTAAACAAAAGTAGGGAGG + Intronic
1086571058 11:88285130-88285152 TAGAATAAATAAAAGAAGGGTGG - Intergenic
1086985942 11:93249305-93249327 CAGAGTAAACCACAGTATGTGGG - Intergenic
1087201705 11:95352054-95352076 CAGAATAACCAAAATTATCCTGG + Intergenic
1087278825 11:96187390-96187412 ATGAATAAACAAAAGAATTGAGG + Intronic
1087977597 11:104569010-104569032 AAGAAGAAAAAAGAGTATGGTGG + Intergenic
1088119044 11:106346316-106346338 TAGAATAAACAAAACTCTTGGGG + Intergenic
1088392453 11:109329787-109329809 TAAAATAAAATAAAGTATGGTGG + Intergenic
1089436642 11:118474411-118474433 GAGAACCAAGAAAAGTATGGTGG + Intronic
1090393021 11:126401786-126401808 CAGAATAAAAACAAGAGTGGAGG + Intronic
1090487168 11:127123715-127123737 CAGATTAAACACAAGTATACAGG - Intergenic
1090778443 11:129985347-129985369 AAGAACAAACAACACTATGGGGG + Intronic
1092867771 12:12779068-12779090 CAGAATGGACAAAGGAATGGAGG - Intronic
1094228365 12:28073339-28073361 CAGAATAGAGAATAGAATGGTGG + Intergenic
1094306955 12:29031088-29031110 CAGAATGAACAAAAGCATAGAGG + Intergenic
1095135430 12:38595526-38595548 AAGAGTAAACAAAAGGATTGAGG - Intergenic
1095546467 12:43376778-43376800 CAGAAGACACAAAACTATGCTGG + Intronic
1095578135 12:43762849-43762871 CAGAAAAAATAACAGTATGTGGG + Intronic
1096209275 12:49750684-49750706 CAGAATTAACAAAAGTTCTGAGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096603158 12:52744911-52744933 CAGCAAAAACATTAGTATGGGGG - Intergenic
1097801106 12:63915418-63915440 CAGAGGAACCAAAAGAATGGGGG + Intronic
1097910722 12:64966253-64966275 GAGAATGAAGAAAAGTAGGGAGG - Intergenic
1098111065 12:67122404-67122426 AAGAAGAGACAAAAGTAAGGAGG + Intergenic
1098409229 12:70162043-70162065 CACTATAAAGAAAAGTATGAAGG + Intergenic
1098653277 12:73001445-73001467 CACTATAAAAAACAGTATGGAGG - Intergenic
1098655541 12:73024642-73024664 CAGAATACCCAAAAGAATGAAGG + Intergenic
1099138645 12:78941699-78941721 GAGAATATAGAAAAGTATGGTGG - Intronic
1099206846 12:79738368-79738390 AAGCATAAACAAAAGTGGGGTGG - Intergenic
1099214769 12:79839950-79839972 CCAAAGAAACAAAAGTATAGGGG - Intronic
1099524464 12:83702565-83702587 CACTATAAAGAAAAGTATGGAGG + Intergenic
1099626354 12:85079728-85079750 CAGAATAAAAAATAGTAAGATGG - Intronic
1100161032 12:91861041-91861063 CAGAATTAACAAATGTCTTGAGG + Intergenic
1101261731 12:103039144-103039166 CAGAATAAACACAAGGAAAGAGG - Intergenic
1101525023 12:105520800-105520822 CAACATAAATAAAAGTGTGGAGG - Intergenic
1101611947 12:106301006-106301028 CAGAATTACCAGAAGTTTGGGGG + Intronic
1104165943 12:126229956-126229978 CAGAGTAAACAGAAGTACAGGGG + Intergenic
1104314308 12:127682746-127682768 CAGAAAAAAAAAAAGTGTGCCGG - Intergenic
1104416964 12:128603512-128603534 CAGACTAAACACAGGCATGGAGG - Intronic
1106310866 13:28553076-28553098 GAGAATAACCAAGAGTAAGGGGG + Intergenic
1106339001 13:28810254-28810276 CAGAAGAAAGAGAGGTATGGGGG - Intergenic
1107156533 13:37173663-37173685 CAGAAAAAAAAAAAAAATGGTGG - Intergenic
1107187098 13:37536320-37536342 AAGAATATGCAAAAGTATGAAGG + Intergenic
1107275888 13:38678746-38678768 CAGAGCAAACAAAATTATGAGGG + Intergenic
1107305606 13:39015007-39015029 CAGTATGAGCAAATGTATGGGGG - Intronic
1107702683 13:43063817-43063839 AAGAATAAACAAAATTATAAGGG + Intronic
1107703880 13:43079450-43079472 CAGAAAAAACAAGAGTTGGGAGG + Intronic
1107850070 13:44562435-44562457 CCGAATAAACATTAGTATTGTGG + Intronic
1108429108 13:50336113-50336135 CAGAATGAACAAAATTTAGGTGG - Intronic
1108776778 13:53774751-53774773 CAGAATTCACAAGAGTATTGAGG - Intergenic
1108833067 13:54503409-54503431 AAGTTGAAACAAAAGTATGGTGG - Intergenic
1109575266 13:64248528-64248550 CAGAATGAACAAAGGAATGAAGG - Intergenic
1109935430 13:69277156-69277178 CAGAAGTAAAAAAAATATGGGGG - Intergenic
1109968969 13:69739528-69739550 CAGACAAAATAAAAGGATGGAGG + Intronic
1110030439 13:70604753-70604775 AAGAATAAACAAAAGGTTAGAGG - Intergenic
1110190011 13:72719365-72719387 CAGAATTATCCTAAGTATGGTGG - Intronic
1110696864 13:78501292-78501314 CAGAATAAACCCAGGTATGAAGG + Intergenic
1111243424 13:85505063-85505085 CAGAATAAACAATTATATTGGGG + Intergenic
1111734182 13:92116096-92116118 CAGAAAAAAAATAAGTGTGGTGG + Intronic
1112048680 13:95623272-95623294 CTTCAAAAACAAAAGTATGGGGG + Intronic
1112489847 13:99852120-99852142 CAGAATAAGCAAATCTATAGAGG + Intronic
1112523005 13:100114845-100114867 CACTATAAAGAACAGTATGGAGG + Intronic
1112788251 13:102975405-102975427 CAGCATAAATAAAATTATGGGGG - Intergenic
1113530582 13:111022200-111022222 CACTATAAATAACAGTATGGAGG + Intergenic
1113544998 13:111141625-111141647 CATAAAAAAAAAAAATATGGAGG - Intronic
1114390586 14:22303821-22303843 AAAAAAAAACAAAAGAATGGGGG - Intergenic
1114962064 14:27904233-27904255 CAGAATAAACACAAATGTGTTGG - Intergenic
1114999951 14:28410094-28410116 CAGAAGAAAAAAAAGAAAGGAGG + Intergenic
1115278033 14:31630355-31630377 AAGAATAAACAAATATGTGGGGG - Intronic
1115807465 14:37067638-37067660 CTCCATGAACAAAAGTATGGAGG + Intronic
1116649907 14:47576907-47576929 AAAAATAAACAAAATTAGGGGGG - Intronic
1117334685 14:54746962-54746984 CAGCAGAAATAAAAGCATGGTGG + Intronic
1117515090 14:56492813-56492835 GAGAATAAGCAGAAGTATGAAGG + Intronic
1118141019 14:63082722-63082744 CATTATGAACAATAGTATGGAGG + Intronic
1119129424 14:72157815-72157837 AAGAATGAACAAAGGAATGGTGG - Intronic
1119419428 14:74499357-74499379 GAGAATAAACAATAGTAAGTAGG + Exonic
1120093102 14:80356651-80356673 CAGAAAAGACAAAGGTATAGAGG - Intronic
1120329371 14:83070324-83070346 CAGTATAGAAAAAAGTATGAAGG - Intergenic
1120981262 14:90291314-90291336 CACAATAAACTAGAGTATGTGGG + Intronic
1122489101 14:102101493-102101515 CAGCATAAGCAAAAGTGGGGAGG - Intronic
1122513409 14:102288475-102288497 CAGAATAAGCAAATCTATAGAGG + Intronic
1123006405 14:105325886-105325908 GAGAGTAAACAAAGGCATGGAGG - Intronic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1124079924 15:26483346-26483368 CAGAAAAAGCAAAAATATGACGG + Intergenic
1124407935 15:29408339-29408361 CAGAATGAAGAAAAATAAGGTGG + Intronic
1124642734 15:31406525-31406547 CAGAAAAAAAGAAAGAATGGAGG + Intronic
1125655478 15:41353301-41353323 CTGAAAAAACAAAAACATGGTGG - Intronic
1126154537 15:45553159-45553181 CAGATTAAGCACAATTATGGGGG + Intergenic
1126882921 15:53118446-53118468 GTGAATAAATAAAATTATGGTGG + Intergenic
1127085426 15:55420011-55420033 AAGAATAAAAAAAAGTATTTTGG + Intronic
1128014032 15:64326643-64326665 CAAAAAAAAAAAAAGTAGGGGGG + Intronic
1128066107 15:64765578-64765600 CAGAATAAAAAAAAGGGCGGGGG + Intronic
1128463366 15:67888276-67888298 CAGAATGAGCAAAAGCCTGGAGG + Intergenic
1128822446 15:70671537-70671559 CAGAATAAAAAAGATTATGTAGG + Intronic
1128850162 15:70946660-70946682 CATTATAAAAAAGAGTATGGAGG - Intronic
1129030820 15:72616461-72616483 CAGTGTAAGCAACAGTATGGAGG + Intergenic
1129209559 15:74059764-74059786 CAGTGTAAGCAACAGTATGGAGG - Intergenic
1129477662 15:75796987-75797009 CAGTGTAAGCAACAGTATGGAGG + Intergenic
1129835725 15:78704259-78704281 CAGTGTAAGCAACAGTATGGAGG + Intronic
1130330154 15:82916134-82916156 CAGAGGAAACAAAATAATGGGGG + Intronic
1130840064 15:87690617-87690639 CAGAATAACCAAAAGAATCTTGG + Intergenic
1130911108 15:88271431-88271453 CAGGATAAACAAATGTATTTGGG - Intergenic
1131005631 15:88975420-88975442 CACTATAAAAAACAGTATGGGGG - Intergenic
1131780411 15:95850545-95850567 CAGATAAAACAAAAGCGTGGAGG + Intergenic
1132437126 15:101816826-101816848 GAAAATAAACTAAAGAATGGTGG - Intronic
1135692002 16:24545881-24545903 CAGACTAAACTAAAGAATGACGG + Intronic
1135706586 16:24680258-24680280 CAGAAAAAAAAAAAGTATCTGGG + Intergenic
1136045072 16:27609018-27609040 CAGCATGAACAAAGGTTTGGGGG - Intronic
1137438760 16:48480944-48480966 CAGAACAAAGAAAAGGTTGGGGG - Intergenic
1137690280 16:50421692-50421714 AAGCATATACAAAAGTAAGGAGG + Intergenic
1137706592 16:50539794-50539816 CAGAAGAAACAAAATGATGTGGG + Intergenic
1138346332 16:56322519-56322541 CAGCACAAAAAAAAGGATGGTGG - Intronic
1138722155 16:59094882-59094904 CAGAAGAAACACAAGGAGGGAGG + Intergenic
1138991054 16:62391933-62391955 CAGCAGAAACAAGAGTGTGGGGG + Intergenic
1139108655 16:63861798-63861820 CAGAATAGACATAAATATTGTGG + Intergenic
1140583275 16:76255839-76255861 CAAAAAAAAAAAAAGTATGTGGG + Intergenic
1140602491 16:76494076-76494098 TGGAAAAAAAAAAAGTATGGAGG - Intronic
1140630589 16:76847452-76847474 CATAATAAAACAAAGTTTGGGGG - Intergenic
1140897579 16:79338623-79338645 GAGAATAAACAAAAGAGTTGAGG + Intergenic
1141369585 16:83474580-83474602 CAGAAAAAACAAGAGGGTGGGGG + Intronic
1144583548 17:16474074-16474096 CAGAATAATCTAAAGTAAGTTGG + Intronic
1144890102 17:18489559-18489581 CAGCATATGCAAAAGCATGGTGG - Intronic
1145142114 17:20454758-20454780 CAGCATATGCAAAAGCATGGTGG + Intronic
1145793794 17:27644143-27644165 CAGCATATGCAAAAGCATGGTGG - Intronic
1146500800 17:33362827-33362849 CTGAATAAGCAAATGAATGGAGG + Intronic
1147029613 17:37621828-37621850 CAGAATAAAAAAAGGTTTTGAGG - Intronic
1147186241 17:38714755-38714777 AAGAAAAAACAAAAACATGGCGG + Intronic
1147268776 17:39251876-39251898 CAGAATAAACAGATGTAAAGTGG + Intergenic
1147736263 17:42640479-42640501 GAAAAAAAAAAAAAGTATGGTGG - Intergenic
1148969101 17:51463848-51463870 CAAAAGAAAAAAAAGTAGGGGGG - Intergenic
1149509056 17:57222752-57222774 CAAAAAAAAAAAAAGTATTGTGG + Intergenic
1150526602 17:65929849-65929871 CAAAATAAATAAAAGCATGTTGG + Intronic
1152954275 18:23989-24011 CACTATAAACAACAGTTTGGAGG + Intergenic
1153353625 18:4109773-4109795 TAAAATAAAAAAAAATATGGGGG - Intronic
1153847365 18:9062089-9062111 CAGAATAATGAGAAGTATGTGGG - Intergenic
1154002650 18:10495974-10495996 CACTATAAAAAACAGTATGGAGG - Intergenic
1155230077 18:23764242-23764264 CAGATAATATAAAAGTATGGAGG - Intronic
1156954071 18:42940096-42940118 CTGCATAAACAAATGCATGGGGG - Intronic
1157017943 18:43741808-43741830 CAGAATAAAAAAAAGGATCTTGG + Intergenic
1157373591 18:47141710-47141732 CTCAAAAAACAAAAGGATGGAGG - Intronic
1157691763 18:49688595-49688617 CTGAAAAATAAAAAGTATGGAGG + Intergenic
1157882474 18:51333671-51333693 CAGAATAGACAAATCTATAGAGG - Intergenic
1158671196 18:59475509-59475531 CAGAATAAACAAAAGTATGGAGG - Intronic
1158692339 18:59671783-59671805 CAGATTAGATAAAAGGATGGTGG + Intronic
1159055150 18:63455884-63455906 CAGAACAAGCAAATCTATGGAGG - Intergenic
1160043359 18:75365514-75365536 CAAAATAACCAAACCTATGGTGG - Intergenic
1160830510 19:1102718-1102740 GAAAATAAACACAAGTCTGGAGG - Intergenic
1161501241 19:4617238-4617260 CTAAAAATACAAAAGTATGGTGG - Intergenic
1163252624 19:16135274-16135296 AAAAATAAAAAATAGTATGGTGG + Intronic
1163428892 19:17254942-17254964 CAGAATATACAAAGGCTTGGAGG + Intronic
1163481934 19:17561845-17561867 GAGAATATAGAAAAGTATGAAGG - Intronic
1163502360 19:17684179-17684201 CAGCATGAGCAAAAGCATGGTGG - Intronic
1163751525 19:19081136-19081158 AAGAATAAAGAAAAGAAAGGAGG + Intronic
1164935244 19:32205177-32205199 CAAAATAAACAAAAATTAGGTGG - Intergenic
1165185757 19:34019606-34019628 CAGTAAAAACAAAGGGATGGAGG - Intergenic
1165787590 19:38471367-38471389 CAGAATAAACAAAATTATCTGGG + Intronic
1165864559 19:38928671-38928693 CAGAATATACAAAAGCCTGGAGG - Intronic
1167002505 19:46754337-46754359 AAGAAAAAACAAAAGTGGGGTGG - Intronic
1167828697 19:51999713-51999735 CAGAATTAGCAAAACTATGAAGG + Intronic
1168392240 19:56019299-56019321 AATAATAAACACAAGTATGTTGG + Intronic
1168392347 19:56020335-56020357 AATAATAAACACAAGTATGTTGG + Intronic
925830045 2:7884824-7884846 CAGAAAAATAAAAAGTGTGGAGG - Intergenic
926264704 2:11304973-11304995 TAGAATAAATACAAATATGGGGG + Intronic
926775190 2:16415081-16415103 CAGTACAAACAAAAGAATGAAGG + Intergenic
926988548 2:18651331-18651353 CAGAATGAACCATAGGATGGCGG - Intergenic
927061837 2:19430346-19430368 AAAAATGAACAAAAGCATGGAGG + Intergenic
927291885 2:21412762-21412784 CAGAGTAAAGAAAAGTATCATGG + Intergenic
927431886 2:23033492-23033514 CAAAATAAACAATAGTTTGAAGG + Intergenic
927839012 2:26425492-26425514 CATTATAAAAAACAGTATGGAGG - Intronic
928901853 2:36327185-36327207 AAGAACAAACAAAAGCAAGGGGG + Intergenic
929388828 2:41443631-41443653 CAGAATCAACAATAGTATTCTGG - Intergenic
929561613 2:42959888-42959910 CAGAAAAAAGAAAAGGCTGGGGG - Intergenic
930326140 2:49921322-49921344 GAGAGGAAAAAAAAGTATGGAGG - Exonic
930341061 2:50115327-50115349 CAGAAGAAACAAATTTCTGGGGG + Intronic
930484180 2:51991794-51991816 AAAAATAAAGAAAAATATGGTGG - Intergenic
930575040 2:53136298-53136320 CAGCATAAGCAAAAGCTTGGAGG + Intergenic
931862965 2:66376342-66376364 CAGAAAAAATAGCAGTATGGAGG - Intergenic
933408229 2:81889988-81890010 CAGAATGCACACAAGAATGGAGG + Intergenic
933465781 2:82649539-82649561 CAGAATAAGCAAACCTATTGAGG + Intergenic
934016384 2:87889621-87889643 CAAAATAAACAAGAGTCAGGAGG + Intergenic
935952973 2:108347878-108347900 CATTATAAACAACAATATGGGGG - Intergenic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
936261670 2:110965418-110965440 CACTATAAAAAACAGTATGGAGG - Intronic
936274757 2:111085177-111085199 CAGAAAAAACAAAAGTATTCAGG + Intronic
936685898 2:114826341-114826363 CAAAATATGTAAAAGTATGGTGG + Intronic
937779049 2:125816274-125816296 CAGAACAAACAAAAGAAAGAAGG + Intergenic
937937041 2:127254456-127254478 CAGACAGAACAAAAGGATGGAGG - Intergenic
940514117 2:154658258-154658280 TAAAATAAAGAAAAGAATGGTGG - Intergenic
942073260 2:172334447-172334469 CAGAATAAAAAAGAGTTTTGTGG - Intergenic
942350280 2:175045603-175045625 CATTATAAAAAACAGTATGGGGG - Intergenic
944181903 2:196904731-196904753 AAAAATAAATAAAAGTCTGGAGG + Intronic
944472694 2:200071938-200071960 CAGTATAATCAAAGGCATGGAGG + Intergenic
944590236 2:201210089-201210111 TAGCATGAACAAAAGCATGGGGG + Intronic
945526222 2:210890598-210890620 CAGAAAATAAAAAAGAATGGAGG + Intergenic
945868193 2:215200114-215200136 CAGAAAAAACAGAAGTTTTGAGG + Intergenic
946677375 2:222175699-222175721 CAGAAATTAAAAAAGTATGGTGG + Intergenic
947682753 2:232050694-232050716 TCGAATAAACAAATGGATGGTGG - Intronic
948495000 2:238342665-238342687 AAAAATAAACATAAGTTTGGCGG - Intronic
1169418291 20:5436815-5436837 CAAAATAAATAAAATGATGGTGG - Intergenic
1170897162 20:20425845-20425867 CAGAAGTAGCAAAAGTATGTTGG + Intronic
1174334880 20:49852830-49852852 CAAAACAAACAAAAGGCTGGGGG - Intronic
1174480203 20:50825900-50825922 CTAAATAAACAAAAATAAGGGGG + Intronic
1175572749 20:60036621-60036643 CAGAGTAAGCAAAAGCCTGGAGG - Intergenic
1175809099 20:61848008-61848030 AAGAATAAACAGACGAATGGAGG - Intronic
1177523267 21:22258897-22258919 CAGACTATACAAAAGTATAGAGG + Intergenic
1178116726 21:29425516-29425538 AAGAAGAAACAGAAGTGTGGGGG + Intronic
1178187726 21:30243071-30243093 CAGATTTAATAAAAGTATGAAGG - Intergenic
1178245324 21:30945091-30945113 CAAAATAAAAAAAAAGATGGTGG + Intergenic
1178368689 21:32009214-32009236 CACAATAAACAAAAAAATAGAGG + Intronic
1178984464 21:37291037-37291059 GAGAACAATTAAAAGTATGGGGG + Intergenic
1178984520 21:37291346-37291368 AAAAAAAAAAAAAAGTATGGGGG + Intergenic
1180287489 22:10762280-10762302 AAGAATAACCAAAAAAATGGGGG - Intergenic
1181591927 22:23890621-23890643 CAGAATGAACCAGAGAATGGGGG - Intronic
1182285922 22:29246954-29246976 AAAAATAAACAAAAATATTGGGG - Intronic
1182959944 22:34462762-34462784 CAAAAGATACCAAAGTATGGGGG - Intergenic
949382649 3:3463577-3463599 CTGAAGAAACAAAAGTCAGGGGG - Intergenic
950390163 3:12690289-12690311 CAAAATAAACAAATAAATGGTGG - Intergenic
950914135 3:16626550-16626572 CAGAATAAAAAAAACAAGGGTGG + Intronic
951927868 3:27928786-27928808 CACAATAGACAAAATTTTGGGGG + Intergenic
952147107 3:30545315-30545337 CAGAACAAAGAAAAGTGTTGGGG + Intergenic
953752977 3:45623598-45623620 CAGAATGAAAAAAAGTAGGCTGG + Intronic
955176309 3:56617448-56617470 GAGAAGAAAAAAAAGTAAGGAGG + Exonic
955506116 3:59634872-59634894 CAGAAAACACAGAAGTAGGGTGG - Intergenic
955537979 3:59944446-59944468 AAAAATAAACGAAAGTGTGGAGG - Intronic
956655164 3:71542862-71542884 CAGATAACACAAAAGCATGGAGG + Intronic
957480121 3:80781763-80781785 CAGAATAGACAAATATATAGGGG - Intergenic
957686230 3:83505999-83506021 CAGAATAGACAAAACTATCCTGG + Intergenic
958879735 3:99655897-99655919 AGGAAGAAAGAAAAGTATGGAGG + Intronic
959246171 3:103871760-103871782 CAGTATAAAAAGCAGTATGGAGG + Intergenic
959312137 3:104752321-104752343 CAGAATAAACAAACTTATATAGG + Intergenic
959612278 3:108308582-108308604 CAGTATGAAGAAAAGTTTGGAGG - Intronic
959653258 3:108772286-108772308 AAAAAAAAAAAAAAGTATGGTGG - Intergenic
960327475 3:116315130-116315152 TAGAATAAGCAAAAGCCTGGAGG - Intronic
960781749 3:121327315-121327337 CAGAGTAATCAACAGTTTGGTGG - Intronic
960875429 3:122290711-122290733 AAGAATAAAGAAAAATTTGGAGG - Intergenic
960893473 3:122476833-122476855 CAGTATGAAAAACAGTATGGAGG + Intronic
962513178 3:136123187-136123209 GAAAAGAAACAAAGGTATGGTGG + Intronic
962712524 3:138100022-138100044 CAAAAAAAAAAAAAGGATGGGGG - Intronic
963265853 3:143239297-143239319 CAGACTGAAGAAAAGTATGATGG - Intergenic
964200863 3:154117736-154117758 CAGGATAAGCAAAAACATGGAGG - Intergenic
964501261 3:157350940-157350962 CAGTATAGAGAACAGTATGGAGG + Intronic
965266747 3:166553075-166553097 CAGAAGAAACAAGAGTATTTGGG - Intergenic
965379476 3:167970205-167970227 CACTATAGACAATAGTATGGAGG + Intergenic
966308953 3:178572148-178572170 CAGCATATACAAAAGAAGGGTGG + Intronic
967062302 3:185882826-185882848 AAAAAAAAAAAAAAGTATGGGGG + Intergenic
967728798 3:192887593-192887615 CAGAAAAAACAAAGGTATATGGG + Intronic
968354791 3:198097565-198097587 CAGAAACAACAATAGGATGGTGG + Intergenic
970319812 4:14863830-14863852 CAGAATAAAGGAAAGAATGTTGG - Intergenic
970502040 4:16687865-16687887 CATCATAAGCAAAAATATGGGGG + Intronic
971577703 4:28297639-28297661 CTGACCAAAAAAAAGTATGGGGG - Intergenic
972098645 4:35382758-35382780 TATAATAAACAGAAGTATGTTGG - Intergenic
972504813 4:39711027-39711049 CAGTAAAAACAAAAATATGAAGG - Intronic
974054448 4:56971328-56971350 AAAAAAAAAAAAAAGTATGGTGG + Intronic
975256332 4:72240057-72240079 AAGATTAAACAAAAGGAAGGAGG + Intergenic
975822022 4:78280572-78280594 AAAAAAAAAAAAAAGTATGGAGG - Intronic
976603035 4:86956626-86956648 CAGAATAGGCAAAATTATTGAGG - Intronic
976841366 4:89436467-89436489 CAGAATAAACAGCACTATGGAGG - Intergenic
977084588 4:92576844-92576866 CAGAATGAAAAAAAGCAGGGTGG - Intronic
977471596 4:97450267-97450289 CAGAATAAATAAAAGAAGGAGGG - Intronic
977963815 4:103118897-103118919 CAGAATAAGCAAGAGGATAGAGG - Intronic
978622006 4:110641866-110641888 AAGAATAAGCAAAAGGAAGGAGG - Intronic
979406256 4:120314149-120314171 AAGAAAAAACAAAAGCATTGAGG - Intergenic
979575030 4:122280042-122280064 CTGCATTAACAAAAGTTTGGAGG + Intronic
979734706 4:124068991-124069013 CACAATGAACAAAAGAATGTTGG + Intergenic
980283691 4:130755493-130755515 CATTATAAAAAACAGTATGGAGG - Intergenic
980333758 4:131441645-131441667 GAGAACAAAGAAAAGTAGGGTGG - Intergenic
980772201 4:137389613-137389635 CACAATTAACAATTGTATGGCGG - Intergenic
980843171 4:138291477-138291499 CAGCATAAACTAAAATTTGGGGG - Intergenic
982016455 4:151158690-151158712 AAAAATAAATAAAAGTATTGAGG + Intronic
982316070 4:154033458-154033480 CAAAAAAAAAAAAAGGATGGTGG + Intergenic
982498731 4:156127394-156127416 CAGAAAATGCAAAACTATGGAGG + Intergenic
982933480 4:161439244-161439266 CAGAACAAACAAACAAATGGTGG + Intronic
983388417 4:167097020-167097042 CAGAATAAATAAAATTATTAGGG - Intronic
983990773 4:174117165-174117187 GAGGAGAAACAAAAGTTTGGAGG - Intergenic
984189284 4:176585584-176585606 CAGAATAACCAAAGGTACGTGGG - Intergenic
986815809 5:11409091-11409113 TAGTAAAAACAGAAGTATGGGGG - Intronic
987160976 5:15142108-15142130 CATAATAAGCAAAAGTTGGGTGG - Intergenic
988192222 5:27953342-27953364 CAGGAAAAACTAATGTATGGTGG - Intergenic
988389931 5:30615250-30615272 CAAAAGAAACAAAACAATGGTGG - Intergenic
988739199 5:34053328-34053350 CAGAATAAAGAAATGTATTTGGG - Intronic
989280870 5:39641867-39641889 CAGATTATGAAAAAGTATGGGGG + Intergenic
989663266 5:43822953-43822975 CACAATGAAAAACAGTATGGAGG - Intergenic
989691201 5:44146533-44146555 AAGAAAAAACATAAGTCTGGAGG - Intergenic
990326357 5:54679657-54679679 CAGTTTAAATAAAATTATGGCGG + Intergenic
990801040 5:59603567-59603589 CATTATAAAAAATAGTATGGAGG + Intronic
990842343 5:60096549-60096571 AAGAATAAACAAAAATATATAGG + Intronic
991104148 5:62825095-62825117 CACAATAAAAAGAAGTATGTCGG - Intergenic
991460625 5:66854749-66854771 CAGACTAAAAAAAGGTATGAAGG + Intronic
991775093 5:70076861-70076883 CACAATAAAAAAAAGTCTGCTGG - Intronic
991854386 5:70952281-70952303 CACAATAAAAAAAAGTCTGCTGG - Intronic
991941399 5:71855916-71855938 CGGAATAAACAAACCTATAGAGG - Intergenic
992322557 5:75628393-75628415 CATAATAAAAAAAATTGTGGGGG + Intronic
992624348 5:78623648-78623670 AAGTATAAACAAAAGTGAGGTGG - Intronic
992689871 5:79231712-79231734 CGAAAAAAAAAAAAGTATGGAGG - Intronic
992735095 5:79711623-79711645 GAGAATAAATAAAAAAATGGGGG + Intronic
992745225 5:79813091-79813113 CAGAATAAATAAATATATTGTGG - Intergenic
992770637 5:80044009-80044031 CAGCAGGAACAAAAGGATGGAGG - Intronic
992819000 5:80475490-80475512 GAGGATAAAGAAAAGTATGAAGG - Intronic
993461093 5:88183023-88183045 TAGAATAAACTAATGTACGGTGG - Intergenic
993775429 5:91989069-91989091 TAGAAAAGGCAAAAGTATGGAGG + Intergenic
993896146 5:93537719-93537741 CATTATAAAAAAGAGTATGGTGG + Intergenic
994386860 5:99143089-99143111 CACTATAAAGAACAGTATGGAGG + Intergenic
994665255 5:102697132-102697154 CAGCAAAAGCAAAAGCATGGAGG - Intergenic
995009905 5:107245579-107245601 AAAAAAAAAAAAAAGTATGGGGG + Intergenic
995182565 5:109242286-109242308 TAGCTTAAAAAAAAGTATGGAGG + Intergenic
995304413 5:110627581-110627603 AAGAAATAACAAAAGTATGGGGG + Intronic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995671339 5:114607047-114607069 CATAATAGAAAACAGTATGGAGG - Intergenic
996471631 5:123867722-123867744 CAGAAAAAACATAGCTATGGTGG + Intergenic
996644970 5:125802989-125803011 CAGAAAAAACAAAAGCATAGTGG - Intergenic
997404322 5:133632653-133632675 CAAAAAACACAAAACTATGGAGG - Intergenic
998100697 5:139431405-139431427 CAGAATAAGCAAATCTATAGAGG - Intronic
998174995 5:139896227-139896249 CAGAACAAACAGACATATGGTGG + Intronic
998540386 5:142975947-142975969 CTGAATAAACCACCGTATGGAGG + Intronic
998973826 5:147622823-147622845 CACTATGAAAAAAAGTATGGTGG - Intronic
999644028 5:153700436-153700458 AAGTATAAACAATAGGATGGTGG + Intronic
1000146214 5:158455532-158455554 CAGCATATACAAAGTTATGGTGG + Intergenic
1000552096 5:162679682-162679704 AAGAAAAAAAATAAGTATGGTGG + Intergenic
1000855574 5:166394089-166394111 GAGAATAAGCAAAAGTATAAAGG - Intergenic
1001573118 5:172743834-172743856 CAGCATATGCAAAGGTATGGAGG + Intergenic
1004121481 6:12826957-12826979 CAGAATAAATAAAATTTGGGTGG - Intronic
1004672252 6:17808548-17808570 CAGAATACACAAAATTTTAGTGG - Intronic
1004741652 6:18467538-18467560 CAGAATCAACAAAACTAGGTTGG + Exonic
1005680369 6:28200974-28200996 CACTATAAAAAACAGTATGGTGG - Intergenic
1006508282 6:34505623-34505645 AAAAAAAAAAAAAAGTATGGAGG - Intronic
1006543698 6:34761671-34761693 AAAAATACAAAAAAGTATGGTGG - Intronic
1007681122 6:43634192-43634214 AAGAAAAAAAAAAAGGATGGAGG - Intronic
1008110233 6:47484119-47484141 CAAAATAAACAAAAGCTGGGAGG - Intronic
1009246028 6:61238613-61238635 CAGTATAAAGAACAGTTTGGAGG + Intergenic
1009851277 6:69202320-69202342 CAGCATATAGAAAAGTATAGAGG - Intronic
1010283248 6:74044804-74044826 CAGAATAAAACAAAGTTTAGTGG + Intergenic
1010471918 6:76238561-76238583 AAGAATAAACTAAACTAAGGAGG + Intergenic
1010939779 6:81902878-81902900 CAGAATGTACAAAGGTGTGGAGG + Intergenic
1011920896 6:92576764-92576786 CAGAATAAAGAAAAGCAAGGTGG + Intergenic
1012406885 6:98910666-98910688 AAGAAAAAAAAAAAGTATTGTGG + Intronic
1012746480 6:103096499-103096521 CAGAATAAACAGAAATACAGGGG - Intergenic
1012874462 6:104710263-104710285 CACAATAAGCAAATCTATGGAGG + Intergenic
1012882998 6:104814117-104814139 AAGAATAAAGAAAAGAAAGGGGG + Intronic
1012994791 6:105962213-105962235 AAAAAAAAAAAAAAGTATGGAGG + Intergenic
1013032426 6:106347183-106347205 CAGAAAAAAAATATGTATGGTGG + Intergenic
1013097213 6:106956492-106956514 GAGAATACAGAAAAGTATGTGGG - Intergenic
1013572723 6:111445860-111445882 CAGTTTAAGCAAAGGTATGGGGG + Intronic
1013762006 6:113529793-113529815 CAGAGTAAGAAAAAGTATGGGGG - Intergenic
1015335558 6:132033679-132033701 TAGGATAAACAAAAGAGTGGTGG + Intergenic
1015755048 6:136598382-136598404 CAGACTAAACTATACTATGGTGG + Intronic
1015927823 6:138328010-138328032 CAGCATAAACACCTGTATGGGGG - Exonic
1016423928 6:143913830-143913852 GAGAATGAAGAAAAGTAGGGTGG - Intronic
1017266845 6:152456168-152456190 AAGTAAAACCAAAAGTATGGTGG + Intronic
1018004999 6:159613495-159613517 CAGGACAAACCAAAGGATGGAGG + Intergenic
1018043198 6:159943306-159943328 CAGAATCAACAACCGTAAGGAGG + Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019785205 7:2972408-2972430 CAGAAGAAAAAGAAGTAGGGTGG + Intronic
1020107082 7:5427112-5427134 CTGGGTAAACAAAAGTATGAGGG - Intergenic
1020625132 7:10568578-10568600 CAGAATAAAGAAATCTATAGAGG + Intergenic
1020713845 7:11644078-11644100 CACAATACACAAAAGAATGAAGG - Intronic
1021020676 7:15594754-15594776 CAGAAGAAAAAAAAATATTGCGG + Intergenic
1021280993 7:18718168-18718190 CAGAACACACAAATTTATGGAGG - Intronic
1021923393 7:25510200-25510222 CATAATGAACAACAGTTTGGAGG + Intergenic
1022053322 7:26701907-26701929 AAGAATAAGCAAAAATATTGTGG - Intronic
1022687884 7:32613582-32613604 AAAAAAAAAAAAAAGTATGGAGG - Intergenic
1023097705 7:36679305-36679327 AAAAATAAAAAAAAGTATTGAGG + Intronic
1023714887 7:43033821-43033843 CACTATAAAAAACAGTATGGTGG + Intergenic
1024226637 7:47330584-47330606 CAGCAGAAACAAAAGGACGGAGG + Intronic
1024414311 7:49084267-49084289 AAAAATAACCAAAATTATGGAGG + Intergenic
1024655302 7:51446897-51446919 CAGGATAAAAAACAGGATGGAGG - Intergenic
1024909555 7:54429462-54429484 CAGAATAAAAAAAAGTGTCCAGG + Intergenic
1025696529 7:63779134-63779156 CTGAAGAAACTAAAGTAAGGTGG + Intergenic
1025913308 7:65845495-65845517 CTGAAGAAACTAAAGTAAGGTGG + Intergenic
1025968847 7:66302982-66303004 CAGAAGGAACAAAGGTATGGAGG - Intronic
1027475585 7:78627305-78627327 CTGAATATTCAGAAGTATGGTGG - Intronic
1027491229 7:78829062-78829084 CAAAATACACAAAAATATGAAGG - Intronic
1028115762 7:86995945-86995967 CAGAAGAAACACAAGTAACGTGG + Intronic
1028781423 7:94741442-94741464 AATAATAAAAAAAAGTATGTGGG + Intergenic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1030372327 7:108714619-108714641 AAAAATAAACAAAAGTATGTAGG + Intergenic
1030735228 7:113040168-113040190 AAGAATAACAAAAAGTATGCAGG - Intergenic
1031211564 7:118835202-118835224 CAGAATAATCAAAAAGCTGGTGG + Intergenic
1031303869 7:120099202-120099224 CAGAAAAAAGAAAAATATTGTGG - Intergenic
1031406436 7:121392990-121393012 CAGAATAGATAAATTTATGGGGG + Intronic
1031412191 7:121453096-121453118 CACTATAAAGAACAGTATGGAGG - Intergenic
1032904831 7:136352117-136352139 GAGAATGAACAAAAGTCTAGAGG - Intergenic
1033272183 7:139942322-139942344 CAGAATAAACAAAGTTAAGCAGG - Intronic
1033882876 7:145908314-145908336 CAGAAAAAAAAAAAAAATGGTGG + Intergenic
1034319536 7:150167227-150167249 CACAGTGAACAACAGTATGGAGG - Intergenic
1034603201 7:152283163-152283185 AAGAATAACCAAAAAAATGGGGG - Intronic
1034644863 7:152636344-152636366 CAAAACAAAAAAATGTATGGTGG + Intergenic
1036246716 8:7123889-7123911 CAGGAAAAAAAAAAGTATCGGGG + Intergenic
1036293719 8:7518105-7518127 CAAAAGACACAAAAGCATGGCGG - Intergenic
1036328842 8:7802890-7802912 CAAAAGACACAAAAGCATGGCGG + Intergenic
1036405428 8:8450634-8450656 CAGAAAAAAAAAAAGTGTCGTGG + Intergenic
1036793796 8:11741155-11741177 CAAGTGAAACAAAAGTATGGTGG - Intronic
1036908389 8:12728858-12728880 CAGGATATACGAAAGTATGCTGG + Intronic
1037042837 8:14259050-14259072 CATAAAAAACTAAAGTATAGAGG - Intronic
1037482225 8:19315011-19315033 AAAAATAAATAAAAGTATTGTGG - Intronic
1037499868 8:19475180-19475202 CAGAGTGTACAAGAGTATGGAGG + Intronic
1037648193 8:20812904-20812926 GAGAACAAACAAAAGAATTGAGG - Intergenic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1037777857 8:21847595-21847617 CAGAATGACCAACAGTAGGGAGG - Intergenic
1038003106 8:23407137-23407159 CAGATGAAACAAAATGATGGCGG + Intronic
1038365811 8:26933183-26933205 CAGAACAAAGAAAATAATGGTGG + Intergenic
1039652421 8:39356608-39356630 CAGAATCAACAAAAGTATTCTGG - Intergenic
1040800905 8:51338805-51338827 CAAAATAAGCAAAAGTATAGCGG + Intronic
1041059932 8:54025359-54025381 CAGAATATTCAAGAGTATAGAGG - Intergenic
1041341023 8:56845482-56845504 CACTATAAAGAACAGTATGGAGG + Intergenic
1042208110 8:66349305-66349327 AAGAATAAAGAAAATTAAGGAGG + Intergenic
1042603504 8:70523331-70523353 CTGAAAAAAAAAAAGTATGTGGG + Intergenic
1043600126 8:81927710-81927732 CAGAATAAATAAAAGAACTGAGG + Intergenic
1044451174 8:92336764-92336786 GAGAACAAAGAAAAGCATGGTGG - Intergenic
1044470820 8:92564796-92564818 AAGAAGAAACAAAAGTATTGTGG + Intergenic
1045622706 8:104000627-104000649 CAGTATAGAAAACAGTATGGAGG - Intronic
1045901068 8:107280601-107280623 TAGCATAAACAAAGGCATGGAGG + Intronic
1046120892 8:109845381-109845403 CATTATGAAAAAAAGTATGGAGG - Intergenic
1047380235 8:124355024-124355046 CAGAAAAGAAAAAAGTATGATGG + Intronic
1047524220 8:125618678-125618700 CAGGATAACCCAAAGGATGGAGG - Intergenic
1047617394 8:126573965-126573987 CATAAAAAACAAAAATTTGGTGG - Intergenic
1048134774 8:131737960-131737982 GTGAATAAACAAAAGTTTGAGGG + Intergenic
1048886992 8:138916646-138916668 CAAAGGAAACAAAAGTCTGGAGG + Intergenic
1049865105 8:144930157-144930179 CTGTATAAAGAAAAGTAGGGTGG + Intergenic
1050491109 9:6188733-6188755 CAGCATTAACAAAAGGATGCTGG + Intergenic
1050661726 9:7890606-7890628 AAAAATAAATAAAAGTATGTTGG - Intergenic
1050747665 9:8895747-8895769 CACAGTAAACTAAAGTCTGGAGG - Intronic
1051201018 9:14623936-14623958 CATTATAAAAAACAGTATGGAGG + Intronic
1051227635 9:14918574-14918596 CACTATAAAAAAAAGTGTGGTGG + Intergenic
1053330179 9:37198702-37198724 CAGAATATACACAAGTTTGAGGG - Intronic
1053610112 9:39704571-39704593 CAGAATACATCAAAGTCTGGGGG - Intergenic
1053701795 9:40701085-40701107 TATAATAAACAAAAGTAATGTGG - Intergenic
1054088141 9:60766576-60766598 CAGAATACATCAAAGTCTGGGGG + Intergenic
1054243412 9:62637824-62637846 CAGAATACATCAAAGTCTGGGGG + Intergenic
1054557536 9:66672345-66672367 CAGAATACATCAAAGTCTGGGGG + Intergenic
1055102098 9:72476417-72476439 GAGAATAAACAAAATTTTGGAGG + Intergenic
1055265823 9:74495328-74495350 GAGAATATAAAAATGTATGGGGG + Intergenic
1055361672 9:75497545-75497567 CAGAAAAAGCAAATTTATGGTGG - Intergenic
1055508152 9:76969020-76969042 CAGAGTAAACAAAGGTATTGAGG - Intergenic
1055842794 9:80526232-80526254 GAGAATAAAGAAAAGCATAGCGG + Intergenic
1057619263 9:96620019-96620041 CAGAAGAAACAAAAGTTGGGGGG - Intergenic
1057870970 9:98717082-98717104 TAGAATGAGCAAAGGTATGGAGG - Intergenic
1057985661 9:99711287-99711309 CAGCAGAAAGAAAAGTATGCTGG - Intergenic
1058867667 9:109176433-109176455 CAGAATAAATGAAAGAATGTAGG + Intronic
1059001510 9:110353399-110353421 CAGCATACACAAAAGTAGAGAGG + Intergenic
1059221744 9:112628041-112628063 GAGTATAAATAAAAGTATAGTGG - Intronic
1059687803 9:116654238-116654260 CACAATAAATAAATGAATGGGGG - Intronic
1059976684 9:119725189-119725211 CAGACAAAACAAAAGCTTGGAGG - Intergenic
1060147366 9:121264618-121264640 CAGAATAAGCAAAGGTGTGGAGG - Intronic
1185665162 X:1759868-1759890 CAGAATACAAAAAGGTAAGGGGG + Intergenic
1186315409 X:8364618-8364640 CAGAATAAGCAAATGCATGAAGG - Intergenic
1186721286 X:12307050-12307072 CTGAATGAACACAAATATGGAGG + Intronic
1186771937 X:12826891-12826913 CAAAAAAAACAACATTATGGAGG + Intergenic
1186790771 X:12996185-12996207 CAGAAAAAACAAAAATCTGGAGG + Intergenic
1187580540 X:20603011-20603033 CAGCATGAACAAAAGCATGCCGG - Intergenic
1187728815 X:22232652-22232674 CAAAATAAATAAAGGGATGGAGG - Intronic
1188092393 X:25978988-25979010 CAGACAAAACAAAGGGATGGAGG + Intergenic
1188228232 X:27628500-27628522 CATAATGGAGAAAAGTATGGAGG - Intronic
1188694404 X:33172225-33172247 CAAAGGAAATAAAAGTATGGCGG - Intronic
1188894033 X:35644192-35644214 CACAATACCCCAAAGTATGGTGG - Intergenic
1190009825 X:46774922-46774944 GAGCATTCACAAAAGTATGGAGG + Intergenic
1191625946 X:63271688-63271710 CAGAAAAAAAAAAAGGGTGGGGG - Intergenic
1191744571 X:64472253-64472275 CAGAATAAACAAATCTATAACGG - Intergenic
1191784358 X:64901767-64901789 CAAAATAAACCAAAGTATTAAGG - Intergenic
1192465248 X:71350395-71350417 CAGAATAAAGAAAAGTGAGCCGG - Intergenic
1192473041 X:71416087-71416109 CAGAATAAAGAAAAGTGAGCCGG + Intronic
1193248172 X:79255201-79255223 CAGAATAACCAAAACTATCCTGG + Intergenic
1193298529 X:79861195-79861217 CAGAATAAACAAATTTATAGAGG - Intergenic
1193374305 X:80740209-80740231 AAGAATAAACAAAAGTAAATGGG + Intronic
1193780119 X:85691112-85691134 CAGACTGAACACAAGCATGGAGG - Intergenic
1194071732 X:89332497-89332519 AAGTATAAAGAAAAATATGGAGG - Intergenic
1194374897 X:93120272-93120294 TGGAAAAAACAAAAGTGTGGTGG - Intergenic
1194390664 X:93313848-93313870 CAAAATAAAAAAAACAATGGGGG + Intergenic
1194464550 X:94217344-94217366 CAGAAACACCAAAAGTATGGGGG - Intergenic
1194534971 X:95094924-95094946 CATACTAACCAAAATTATGGAGG + Intergenic
1195478297 X:105313575-105313597 AAGAATAAACAAATGGAGGGGGG - Intronic
1195725420 X:107910570-107910592 CATTATAAAAAACAGTATGGAGG - Intronic
1195791128 X:108587689-108587711 CATTATGAAAAAAAGTATGGAGG - Intronic
1196226405 X:113172566-113172588 CAGATAAAACAAAAAGATGGAGG + Intergenic
1196846937 X:119903935-119903957 AAAAATAAACAAAATAATGGTGG - Intronic
1197032155 X:121829438-121829460 AACAATAAATAAAAGTAGGGTGG - Intergenic
1197090783 X:122534054-122534076 CAGAACAGAGAACAGTATGGAGG + Intergenic
1197326452 X:125100184-125100206 CAGAATAATCAAAAATTAGGGGG + Intergenic
1197654013 X:129096549-129096571 CAGAATAAACTAAACTATGATGG - Intergenic
1198654179 X:138895578-138895600 CATAATGAAAAATAGTATGGAGG + Intronic
1199051363 X:143240340-143240362 CAGAATGAACAACTGGATGGGGG - Intergenic
1199128101 X:144148919-144148941 CAAAATAAACAAGAGTCAGGAGG - Intergenic
1199349625 X:146785783-146785805 AATAATAAACAAAATTATGGTGG + Intergenic
1199539383 X:148942238-148942260 CAGGATAAGCAAAGGCATGGAGG + Intronic
1199907013 X:152242784-152242806 CATTATAAAAAACAGTATGGAGG + Intronic
1199925844 X:152462902-152462924 GAGAATAAACATAACTAGGGAGG + Intergenic
1200725980 Y:6668225-6668247 AAGTATAAAGAAAAATATGGAGG - Intergenic
1200797506 Y:7354793-7354815 CACCATAAAGAAGAGTATGGAGG - Intergenic
1201267566 Y:12223041-12223063 TGGAAAAAACAAAACTATGGAGG + Intergenic
1201680119 Y:16636506-16636528 CACAATATAGAAAAATATGGGGG + Intergenic
1202303759 Y:23445859-23445881 GAGAATAAAAAAAAGTATGGAGG + Intergenic
1202567051 Y:26224734-26224756 GAGAATAAAAAAAAGTATGGAGG - Intergenic