ID: 1158674787

View in Genome Browser
Species Human (GRCh38)
Location 18:59508305-59508327
Sequence GAAACTTGCCTCACTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158674782_1158674787 21 Left 1158674782 18:59508261-59508283 CCAGAGTTAGAATTCCAGTTTTA 0: 1
1: 1
2: 6
3: 68
4: 515
Right 1158674787 18:59508305-59508327 GAAACTTGCCTCACTGGGTGTGG 0: 1
1: 0
2: 0
3: 16
4: 173
1158674783_1158674787 7 Left 1158674783 18:59508275-59508297 CCAGTTTTATCATCTGCTAAATG 0: 1
1: 2
2: 30
3: 265
4: 1306
Right 1158674787 18:59508305-59508327 GAAACTTGCCTCACTGGGTGTGG 0: 1
1: 0
2: 0
3: 16
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158674787 Original CRISPR GAAACTTGCCTCACTGGGTG TGG Intronic
900135004 1:1112898-1112920 AAAACTTGCCTTAGTCGGTGGGG + Intronic
901274577 1:7981178-7981200 GAAACTTCCCACAGTGAGTGGGG - Intronic
902101815 1:13996621-13996643 TCATCTTTCCTCACTGGGTGGGG + Intergenic
903892210 1:26577376-26577398 GAATCTTGCCAGACTGGGGGTGG - Intergenic
905193693 1:36257128-36257150 GAAACATGCCTGACTGTCTGAGG - Intronic
906309877 1:44746166-44746188 GAAACCTGCAGGACTGGGTGCGG - Intronic
911863983 1:102993081-102993103 GAAAATTGCCTGACTGGGGTGGG - Intronic
912736167 1:112151363-112151385 GAAAACTACCTAACTGGGTGGGG + Intergenic
912838934 1:113021777-113021799 GGAACTAGCTTCACTGGGAGAGG - Intergenic
916849010 1:168683928-168683950 GACCCATCCCTCACTGGGTGGGG - Intergenic
918895623 1:190340288-190340310 GACATTTGCCAAACTGGGTGAGG + Intronic
921478332 1:215635842-215635864 TAAACCTGCCTGGCTGGGTGCGG - Intronic
922021261 1:221706922-221706944 CAAACTTGTCCCTCTGGGTGAGG - Intronic
923057520 1:230438271-230438293 GAAATTTGTCTTGCTGGGTGTGG - Intergenic
1065575391 10:27112929-27112951 AAAACCTGCCTGGCTGGGTGCGG + Intronic
1067658197 10:48213063-48213085 GAATCTGGCCTCACTGGGGCTGG + Intronic
1069777297 10:70934564-70934586 GGAGCTTGCCTCACTGGGAGGGG + Intergenic
1074562903 10:114549966-114549988 GAAACTTCCCTCTCTGGAGGAGG + Intronic
1075390061 10:122085444-122085466 GAAACTTGCTGCACTGGGCAGGG + Exonic
1075475130 10:122727745-122727767 GTGACTTGCCTGGCTGGGTGGGG - Intergenic
1076440645 10:130479188-130479210 GAAACCTCACTCACTGGCTGGGG + Intergenic
1076574030 10:131452043-131452065 GAAACCTGCGTCTCTGGATGGGG - Intergenic
1076575711 10:131465372-131465394 GAAACTTCCCTCCCAGAGTGGGG + Intergenic
1081255624 11:40890945-40890967 GAAACTTGCCAGACTAGGTTGGG + Intronic
1083549670 11:63577458-63577480 TACACTTGCCTGGCTGGGTGCGG - Intronic
1083792852 11:64997017-64997039 GAAACTTGGCCCTCTGGGGGCGG - Exonic
1083912144 11:65716416-65716438 GAAACTTGCCTGACTGAGCAGGG + Intronic
1083922078 11:65786617-65786639 GAAACTCGCCCCACTGGGGCCGG - Intergenic
1084304120 11:68270744-68270766 GTAGCTTGCCTAACTTGGTGTGG - Intronic
1084344964 11:68540682-68540704 TAAACTGGCCCCCCTGGGTGTGG - Intronic
1085704642 11:78775665-78775687 GGAACTAGCCTCAGTGGGTAAGG - Intronic
1086406963 11:86506901-86506923 GAAACTTGCTTCTCTGGGCCTGG + Intronic
1086992286 11:93316828-93316850 GAAAGTTGCCTGACTGGGGGTGG + Intergenic
1087613495 11:100461918-100461940 ACAACTTGTTTCACTGGGTGTGG + Intergenic
1088765716 11:112974451-112974473 GAAACTTGGTTTATTGGGTGGGG + Intronic
1091082581 11:132685479-132685501 GAAACTTGCCCCACAGGAAGTGG - Intronic
1091250635 11:134141271-134141293 CAAAGTGGCCTCTCTGGGTGCGG + Intronic
1092021666 12:5207839-5207861 GAAACTTGGCTCACTGGGGTCGG + Intergenic
1098984685 12:76999012-76999034 GAAATTAGACTCACTGGGTGTGG + Intergenic
1102226147 12:111229609-111229631 GAAATTTGCCTGGCTGGGTATGG + Intronic
1102400911 12:112628849-112628871 GGAACTTGCAGCAGTGGGTGAGG + Intronic
1105995877 13:25671547-25671569 TAAACTGGCCCCCCTGGGTGTGG + Intronic
1106588367 13:31076722-31076744 GATGGTTGCCTCACTGAGTGAGG + Intergenic
1106674914 13:31948168-31948190 GAAACCTGCCTGACTGAGGGTGG - Intergenic
1107746941 13:43520503-43520525 GAAACTAGGCTAGCTGGGTGGGG + Intronic
1111180627 13:84659662-84659684 GAAACTTTCCTGGCTGGGTGTGG + Intergenic
1111754557 13:92376718-92376740 GAAACTTCCCTGACTGGGCTGGG + Intronic
1112046684 13:95604351-95604373 GAAGCTGGCCTGACGGGGTGGGG + Intronic
1116562733 14:46402179-46402201 TAAATTGGCCTCCCTGGGTGCGG + Intergenic
1116928735 14:50668541-50668563 GAAACCTGCCCCGCTGAGTGCGG + Intergenic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1120756198 14:88246639-88246661 CAAAAGTGCCTCACTGGGTGTGG - Intronic
1124719289 15:32097934-32097956 GAAACTTCCCTCCTGGGGTGAGG + Intronic
1127900235 15:63335735-63335757 CAAACATGCCTCAGTGGATGAGG + Intronic
1129380183 15:75160076-75160098 GAAAATTACCTGGCTGGGTGTGG + Intergenic
1135727937 16:24871561-24871583 GAAACTTGCCCAGCTGGGTGCGG - Intronic
1137489634 16:48920779-48920801 GACACTTGCCTCTCTGGGGAAGG - Intergenic
1138182287 16:54949720-54949742 GAAACCTCCTTCACTGGGTATGG - Intergenic
1141902789 16:87003472-87003494 AAAACTTGCCTCCCTGAGAGAGG + Intergenic
1142296068 16:89223267-89223289 GAACCTGGCCTCAGTAGGTGAGG + Exonic
1149347518 17:55753039-55753061 GAATTTTGCCTGGCTGGGTGTGG - Intronic
1153226606 18:2905277-2905299 GCAACCTGCCTCTGTGGGTGGGG + Intronic
1154384497 18:13880763-13880785 GCCCCTTGCCTCACTGTGTGGGG - Intergenic
1155022019 18:21905326-21905348 GAAAGTTGACTTTCTGGGTGAGG + Intergenic
1156306361 18:35881265-35881287 GAAACTGGCCTCATTGTCTGAGG - Intergenic
1157678239 18:49583491-49583513 GAAAACTGCCACACTGTGTGGGG - Intronic
1158674787 18:59508305-59508327 GAAACTTGCCTCACTGGGTGTGG + Intronic
1160456392 18:79005420-79005442 GGAAGTTGCCCCACTGGGTAAGG - Intergenic
1161138556 19:2634967-2634989 GCTTCTTGCCTCACTGAGTGCGG - Intronic
1161185433 19:2915632-2915654 GAACCTGGCCTCAGTAGGTGAGG + Exonic
1161188519 19:2939275-2939297 GAACCTTGCCTCCTTGGGTAAGG - Exonic
1161268407 19:3375672-3375694 GACTCTGGTCTCACTGGGTGGGG + Intronic
1163667568 19:18610474-18610496 GAAACTGGCCTCCCTGGGGCAGG - Intronic
1166831927 19:45644508-45644530 GCAGCTGGCCTCTCTGGGTGGGG - Intronic
1166881332 19:45932020-45932042 AAAAATTGCCTGACTGGATGTGG - Intergenic
1167539176 19:50074403-50074425 GAACCTTCTCTCCCTGGGTGAGG - Intergenic
1167761396 19:51452145-51452167 GGTACTTGCCTCTCTGTGTGTGG - Exonic
1167864577 19:52314263-52314285 GAACCTGGTCTCCCTGGGTGAGG + Exonic
1167875146 19:52406017-52406039 GAACCTGGTCTCCCTGGGTGAGG + Exonic
1167895306 19:52576005-52576027 GAACCTGGTCTCCCTGGGTGAGG + Exonic
1167900597 19:52618930-52618952 GAACCTGGTCTCCCTGGGTGAGG - Intronic
1167923917 19:52808001-52808023 GAACCTGGTCTCCCTGGGTGAGG - Exonic
1167929089 19:52849081-52849103 GAACCTCGTCTCCCTGGGTGAGG - Exonic
1167933546 19:52888121-52888143 GAACCTGGTCTCCCTGGGTGAGG - Exonic
1167936767 19:52915190-52915212 GAACCTGGTCTCCCTGGGTGAGG - Intergenic
1167957142 19:53075051-53075073 GAACCTTGTTTCTCTGGGTGAGG - Exonic
1167962363 19:53116307-53116329 GAACCTGGTCTCCCTGGGTGAGG - Exonic
1167966181 19:53149235-53149257 GAACCTGGCCTCCCTGGGTGAGG - Exonic
1167969117 19:53175439-53175461 GAACCTGGTCTCCCTGGGTGAGG - Exonic
1167973425 19:53204126-53204148 GAACCTGGTCTCCCTGGGTGAGG + Intergenic
1167989441 19:53345616-53345638 GAACCTGGTCTCCCTGGGTGAGG + Exonic
1167992916 19:53375880-53375902 GAACCTGGTCTCCCTGGGTGAGG + Exonic
1167995917 19:53402175-53402197 GAACCTGGTCTCCCTGGGTGAGG + Exonic
1168001457 19:53449622-53449644 GAACCTGGTCTCCCTGGGTGAGG + Exonic
1168005883 19:53486742-53486764 GAACCTGGTCTCCCTGGGTGAGG + Exonic
1168467363 19:56613922-56613944 GAACCTGGTCTCACTGGGTAAGG + Intronic
1168619361 19:57865415-57865437 GGAACTTTCCTGGCTGGGTGTGG + Intronic
925025077 2:601185-601207 GAGGCCTGCATCACTGGGTGTGG + Intergenic
925785996 2:7431671-7431693 GAACCTGGACACACTGGGTGGGG + Intergenic
928108366 2:28487656-28487678 GAAACTTGCCACACAGAGAGCGG - Intronic
930545785 2:52765915-52765937 CCATCCTGCCTCACTGGGTGGGG + Intergenic
931125246 2:59268734-59268756 GAAACTGGCCTCAAAGGGAGAGG - Intergenic
931787319 2:65631749-65631771 GAAAGTTGCAGCACAGGGTGTGG - Intergenic
934975713 2:98800666-98800688 GACACTTGCCTCACTATGTTTGG + Intronic
937344814 2:121119051-121119073 AACACTTCCCTCACAGGGTGGGG - Intergenic
938289224 2:130140634-130140656 GCAAGATGCCCCACTGGGTGTGG - Intronic
938467302 2:131532304-131532326 GCAAGATGCCCCACTGGGTGTGG + Intronic
943507641 2:188781825-188781847 AAAGATTGCTTCACTGGGTGAGG + Intronic
946149446 2:217754207-217754229 GAAATCAGCCTCTCTGGGTGGGG + Intronic
947963718 2:234261010-234261032 GAAATTTCTCTCGCTGGGTGCGG + Intergenic
948100188 2:235366881-235366903 GGAGCTTGCCTCACTGAGGGAGG + Intergenic
948515907 2:238503805-238503827 GAAGCTTGCCTCAGTGGCGGGGG - Intergenic
1172531635 20:35635031-35635053 CAAACTTGGCTGGCTGGGTGTGG - Intronic
1174474972 20:50790199-50790221 CCTACTTGCCTCACAGGGTGTGG + Intergenic
949218061 3:1595602-1595624 GGAACTTGCCTCCATGGTTGAGG - Intergenic
951039063 3:17968031-17968053 CAAACTTCCCTCAGTGGGGGAGG + Intronic
952360172 3:32623204-32623226 AAAACTAGACTCTCTGGGTGTGG + Intergenic
953345218 3:42170026-42170048 GAGAGTGGCATCACTGGGTGTGG + Intronic
956435509 3:69231252-69231274 GCAACATTCCTCACTGGCTGTGG + Intronic
959686908 3:109157449-109157471 GACATTAGCCTCACTGGGTTAGG + Intergenic
959979221 3:112496313-112496335 GAAACTTGCCCCTCAGTGTGTGG - Intronic
963233369 3:142931911-142931933 AAAATTTGCCTCACTGGGGCTGG - Intergenic
963606452 3:147415606-147415628 GAAACTGACCTCACTGGGCAAGG + Exonic
965450703 3:168834242-168834264 GATACTTGCTTCTCTGGTTGTGG + Intergenic
968377925 4:59540-59562 GAACCTGGTCTCCCTGGGTGAGG + Exonic
968406470 4:343892-343914 GAACCTGGTCTCCCTGGGTGAGG + Exonic
968531193 4:1092540-1092562 GAGACTTGAGACACTGGGTGTGG + Intronic
969547639 4:7841968-7841990 GAAGCTTCCCTCACTGGATTTGG + Intronic
970768990 4:19587243-19587265 TATACTTGCCTCACAGGGTGGGG - Intergenic
973571578 4:52245152-52245174 GGAACAAGCCTCACTGAGTGTGG + Intergenic
974596166 4:64016535-64016557 CCAACTTGTCTGACTGGGTGAGG + Intergenic
975364349 4:73511315-73511337 AAATCATGTCTCACTGGGTGCGG + Intergenic
976142510 4:82007264-82007286 GAAACTAGCCTCACTGGAGGTGG - Intronic
976499462 4:85770832-85770854 GAAAGTTTCCTTACTGGGTTAGG - Intronic
979600522 4:122582393-122582415 GATACTTGCCTCACAGGTGGAGG - Intergenic
985309005 4:188576954-188576976 GAAATTTGCCTGGCTGGGCGGGG + Intergenic
985763696 5:1765319-1765341 GAAACTTGCTTCACGGGGCCAGG + Intergenic
987581608 5:19801026-19801048 GAGAATTGCCTCACTGCTTGAGG + Intronic
989754888 5:44940388-44940410 TAAACTTGCCTCAGTGTGTGGGG - Intergenic
995416616 5:111920446-111920468 GAAACCTGCCTCATTGTCTGAGG + Intronic
997255910 5:132427841-132427863 GAAACTGGCCTCACTTTCTGGGG - Intronic
997337667 5:133119349-133119371 CAAACTGGCCTCCCTGGGTGGGG + Intergenic
997604918 5:135167910-135167932 GAAAGTTGCCACACTGTCTGGGG + Intronic
999467142 5:151818055-151818077 GAACCTTCCCTGGCTGGGTGAGG - Intergenic
1002367819 5:178726993-178727015 GAACCTGGTCTCACTGGGTAAGG - Exonic
1002385827 5:178866354-178866376 GAACCTGGTCTCACTGGGTAAGG + Exonic
1002461708 5:179377075-179377097 AAAACCTGCCTCACTGCTTGTGG - Intergenic
1007603693 6:43100940-43100962 GATAGTTGTATCACTGGGTGCGG + Intronic
1008385211 6:50881235-50881257 GAAACTGGCCTATCTGGGGGAGG + Intergenic
1014033302 6:116735038-116735060 AGCACTTGACTCACTGGGTGTGG + Exonic
1017675324 6:156807149-156807171 CAAAGATGCTTCACTGGGTGGGG - Intronic
1019295858 7:274102-274124 GAAAATTACCTGGCTGGGTGCGG - Intergenic
1023016849 7:35976963-35976985 TAAACTGGCCCCACTGGGCGTGG - Intergenic
1024539577 7:50465264-50465286 GAAAGTGGCATGACTGGGTGTGG + Intronic
1026527326 7:71165879-71165901 TAAACCTCCCTGACTGGGTGAGG + Intronic
1027692408 7:81364640-81364662 GAAACATGCCTGAATGTGTGGGG - Intergenic
1032747631 7:134803984-134804006 GAACCATGCCTGGCTGGGTGTGG - Intronic
1033295515 7:140130766-140130788 GACACTTGTCTCAGTGGGTGGGG - Intronic
1034585877 7:152091670-152091692 GAAACTTTCCTCTCCGGCTGGGG - Intronic
1035294029 7:157857744-157857766 GAGACGTGCCTCACAGGATGTGG - Intronic
1035888824 8:3322706-3322728 CAACCTTGCCCCACTGGCTGTGG - Intronic
1037065516 8:14572489-14572511 TAAACTTCCCTCTCTGGGTTCGG - Intronic
1037764113 8:21761375-21761397 GAAACTTTCCCCTTTGGGTGTGG + Intronic
1038643344 8:29344618-29344640 GAAAATTGCCTCCCTGTATGAGG - Intronic
1039629124 8:39089350-39089372 GAAATTTGGCTCTGTGGGTGAGG + Intronic
1040002644 8:42592202-42592224 GCAATTTGCCTCACTCTGTGGGG + Intergenic
1040659376 8:49552483-49552505 GAAATTTGCCAGACTGTGTGTGG + Intronic
1041114436 8:54521133-54521155 GAAAGTTTCCTGGCTGGGTGTGG - Intergenic
1046944025 8:119958003-119958025 GTAACATGCCTCAGTGTGTGTGG + Intronic
1048925083 8:139264339-139264361 GCAAGTTTCCTCACTGCGTGGGG - Intergenic
1049838245 8:144754186-144754208 GAACGTGGCCTCTCTGGGTGAGG - Exonic
1049841850 8:144778032-144778054 GAACCTAGTCTCACTGGGTAAGG - Exonic
1049846353 8:144803751-144803773 GAACCTGGCCTCACTAGGTGAGG + Exonic
1049897365 9:120491-120513 GAAATTTGCCTCACATGCTGGGG - Intergenic
1049987570 9:965996-966018 GAAACTTCTGTCACTGGTTGGGG + Intronic
1053362261 9:37497063-37497085 GAAACTTGCCCCGCTGGGCACGG + Intronic
1053740458 9:41130761-41130783 GAAATTTGCCTCACATGCTGGGG - Intergenic
1054443453 9:65286935-65286957 GAAATTTGCCTCACATGCTGGGG - Intergenic
1054486823 9:65734568-65734590 GAAATTTGCCTCACATGCTGGGG + Intergenic
1054687892 9:68300541-68300563 GAAATTTGCCTCACATGCTGGGG + Intergenic
1055574620 9:77648509-77648531 CACACTTGCCTCCCTGGCTGGGG + Intergenic
1056707742 9:88966359-88966381 GAAACCTGCCTGGCTGGGTGTGG - Intergenic
1059720289 9:116953122-116953144 GTTATTTGCCTCAGTGGGTGGGG - Intronic
1060891114 9:127189132-127189154 GAAAGTAACCTCACTGAGTGAGG - Intronic
1203571313 Un_KI270744v1:134707-134729 GAACCTGGTCTCCCTGGGTGAGG - Intergenic
1187175943 X:16896506-16896528 GAAACTTGCCTGGCTGGGCGTGG - Intergenic
1188282506 X:28287436-28287458 GGCACTTGCATCCCTGGGTGAGG - Intergenic
1188779538 X:34263914-34263936 AGAAATTGCCTTACTGGGTGGGG + Intergenic
1190356745 X:49612919-49612941 GAAAATTCCCTGGCTGGGTGCGG - Intergenic
1192388870 X:70703809-70703831 GAAACTTGCCAGCCTGGGTTTGG + Intronic