ID: 1158677088

View in Genome Browser
Species Human (GRCh38)
Location 18:59529779-59529801
Sequence CTGTTTCTGGTCATTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158677085_1158677088 -10 Left 1158677085 18:59529766-59529788 CCTCCAACTGCAGCTGTTTCTGG 0: 1
1: 5
2: 11
3: 47
4: 351
Right 1158677088 18:59529779-59529801 CTGTTTCTGGTCATTGATCTTGG 0: 1
1: 0
2: 1
3: 23
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158677088 Original CRISPR CTGTTTCTGGTCATTGATCT TGG Intronic
902101676 1:13995909-13995931 CTGTTTCTGGTCTGCCATCTTGG - Intergenic
902559092 1:17265831-17265853 CTGTTTTTGGCCCTTGGTCTCGG - Intronic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
906415969 1:45621704-45621726 AGGTTTCTGGTCATTGTTCCAGG + Exonic
906908938 1:49925583-49925605 CTGATTCGGGCCATTGCTCTTGG + Intronic
908173390 1:61529750-61529772 GTATTTTTGGTCATTGTTCTTGG - Intergenic
909907307 1:81213726-81213748 TTGTTTCTGGTCATTCAGGTAGG - Intergenic
910509395 1:87986641-87986663 CTGTTACTGGCTATTGACCTGGG + Intergenic
911451781 1:98071364-98071386 CTCTTTCTAGTGATCGATCTAGG + Intergenic
911651634 1:100395702-100395724 CTGTTATTGCTCACTGATCTTGG + Intronic
912544912 1:110443723-110443745 TTGGTTCTGGACATTGTTCTTGG + Intergenic
913176847 1:116281295-116281317 GTGTTTCAGGTTATTGGTCTGGG - Intergenic
913378245 1:118179509-118179531 ATGTTTCAGGACATTGGTCTAGG + Intronic
914703618 1:150154274-150154296 GTGTTTCTGGGAATTGCTCTTGG + Intronic
915579821 1:156806760-156806782 CTGGTTCTAGTCCTTGACCTTGG + Intronic
915990521 1:160511717-160511739 CTGTTTCTAGTTAGTCATCTTGG - Intronic
916973344 1:170048545-170048567 CTGTTTCTGTTCAGCCATCTTGG - Intronic
917709116 1:177666403-177666425 CTGTTTCAGGGCCCTGATCTGGG + Intergenic
917863026 1:179166162-179166184 ATGCTTCAGGACATTGATCTAGG + Intronic
918599115 1:186332487-186332509 ATGTTGATGGACATTGATCTAGG - Intronic
923157894 1:231294516-231294538 CTGTCTCTGAACATTGGTCTGGG - Intergenic
924794471 1:247283185-247283207 CTGTTTCGGGACATCGATCTAGG + Intergenic
924883368 1:248187547-248187569 CTGTTTCTGCTGAGTCATCTTGG - Intergenic
924894141 1:248317385-248317407 CTGTTTCTGCTCAGCCATCTTGG + Intergenic
1063444548 10:6102320-6102342 CTGTTTCACGTCACTGTTCTGGG + Intronic
1063621064 10:7649730-7649752 TCTTTTCTAGTCATTGATCTGGG - Intronic
1064612795 10:17120973-17120995 CTGTTTATGGGCATTTATCAAGG - Intronic
1064887700 10:20129585-20129607 ATGTTTCCTGACATTGATCTGGG - Intronic
1065538218 10:26735231-26735253 CTGTTTCAGGTCTCTGTTCTAGG + Exonic
1066162184 10:32746057-32746079 CTGTGTCTGGTCAGCCATCTTGG - Intronic
1066252547 10:33648670-33648692 CTGTTTGTGGTCATTAGTTTTGG - Intergenic
1067991449 10:51217665-51217687 CTGTTTCTGGCCTTAGTTCTGGG + Intronic
1068026680 10:51654099-51654121 AAGTTTCTTGACATTGATCTGGG - Intronic
1068381263 10:56255948-56255970 CTGTTTCTATTCAGTCATCTTGG + Intergenic
1068848706 10:61710947-61710969 TTGTTTTTGGTGATTGATTTGGG - Intronic
1070186868 10:74072745-74072767 CTGTCTCTCGTCAATCATCTTGG - Exonic
1070805898 10:79270570-79270592 GTGTTGCTTGTCAGTGATCTTGG + Intronic
1073664232 10:105511704-105511726 CTGTTTCTGCTCTGTGATTTTGG + Intergenic
1073716501 10:106114399-106114421 CTGTTTCTAGTCAGCCATCTTGG - Intergenic
1074207339 10:111295105-111295127 ACTTTTCTGGACATTGATCTGGG - Intergenic
1075845589 10:125542646-125542668 CTGTTTCTGCTCCATCATCTTGG - Intergenic
1076728551 10:132425823-132425845 CTGTACCTGGCCATAGATCTGGG + Intergenic
1078879507 11:15434112-15434134 ATGATTCTGGACCTTGATCTGGG + Intergenic
1082885549 11:58078256-58078278 CTGCTTATGGTCATTGCTGTTGG + Intronic
1083510333 11:63203158-63203180 CTACTTCTGGTCTTTGATGTCGG - Intronic
1085536621 11:77224303-77224325 CTGTTTCTATTCAGTCATCTTGG + Intronic
1087248429 11:95868665-95868687 ATGTCTCTGTTCATTGATTTTGG - Intronic
1087540137 11:99506115-99506137 TTGTTACTGGTAGTTGATCTTGG + Intronic
1087617018 11:100498110-100498132 ATTTTTCTGGACATTGACCTGGG + Intergenic
1088397961 11:109389443-109389465 CAGTTTCTGGACAATGATTTTGG + Intergenic
1088765859 11:112976666-112976688 CTGTTTCGAGTCATGTATCTTGG + Intronic
1090507596 11:127335482-127335504 CAGTTGCTGGTCTTTGATATAGG - Intergenic
1092169244 12:6363110-6363132 CTGTTTCTGGTCCTTGATTCAGG - Intronic
1093330902 12:17837339-17837361 GTGTTTCAGGTCATTGGCCTGGG - Intergenic
1093340565 12:17967945-17967967 CTGTTTCTAGTCAGCCATCTTGG + Intergenic
1095121222 12:38422158-38422180 CAGTTTCAGGTCTTTGATTTAGG - Intergenic
1095968083 12:47882878-47882900 CTGTTTGCAGTCACTGATCTGGG - Intronic
1097350931 12:58548326-58548348 CTGTTCCTGGTCAAGGGTCTTGG - Intronic
1097942025 12:65320522-65320544 CTGTTTCTGGTGATGAATTTTGG - Intronic
1099032440 12:77544009-77544031 CCTCTTCTGGACATTGATCTAGG + Intergenic
1099552443 12:84064751-84064773 ATATTTCTGGCCATTGATCGAGG + Intergenic
1099793387 12:87364084-87364106 CTGTTTCTAGTCAGCCATCTTGG + Intergenic
1099899294 12:88687824-88687846 AAGTTTCTGGTTATTGACCTTGG + Intergenic
1101066424 12:101026945-101026967 CTGTTTCTAGTCAGCCATCTTGG - Intronic
1101187324 12:102292683-102292705 CTGTTTCTAGTCAGTCATCTTGG + Intergenic
1102232309 12:111271640-111271662 CTTATTCTGGTCACTGATCCTGG - Intronic
1103307850 12:119980324-119980346 CTGCTTCTTTTCAATGATCTTGG - Intergenic
1108034603 13:46275870-46275892 ATGTTTCAGGACATTGACCTAGG - Intronic
1108136674 13:47370858-47370880 CTGCTTCAGGACATTGAGCTGGG + Intergenic
1108482734 13:50891134-50891156 CTTTCTCTGGTCATTGCTTTGGG + Intergenic
1108747546 13:53410178-53410200 CTGTTTCTCTGCATTGAGCTGGG - Intergenic
1109072631 13:57788006-57788028 CTGTTTCTAGTCAGCCATCTTGG + Intergenic
1109376813 13:61505976-61505998 ATATTTCAGGTCATTGTTCTGGG + Intergenic
1110261627 13:73491533-73491555 CTGTTTGTCCTCATTCATCTCGG - Intergenic
1111098758 13:83551182-83551204 CTGTTTCTGGTCCTTTATAGTGG + Intergenic
1112878038 13:104069607-104069629 CTGTATCTGGTCATTTTTCCTGG - Intergenic
1113930667 13:113967357-113967379 GTGTTTGTGGAGATTGATCTGGG - Intergenic
1113961276 13:114127589-114127611 CTGTTTCTTCTCTGTGATCTTGG - Intronic
1114942821 14:27636842-27636864 CTGTTTCTGGCCATGGCTCAAGG + Intergenic
1115774289 14:36699062-36699084 CTGCTTTTGGTCTTTGATGTTGG + Intronic
1116026949 14:39526693-39526715 CTGCTTCTGGTCTTTGATGATGG + Intergenic
1116250006 14:42469747-42469769 CTGTTTCTAGTCAGCTATCTTGG - Intergenic
1116381803 14:44278286-44278308 CTGTTTCTGCTCTTTGCTTTTGG - Intergenic
1116921021 14:50575024-50575046 CTCTCTCTGGTCCTTGATTTAGG + Intronic
1117311531 14:54529119-54529141 CTGGTTTTGGTCATTGTTCCTGG - Intronic
1117365178 14:55020107-55020129 TTCTTTCTGGTCATTCTTCTGGG + Intronic
1117375449 14:55114739-55114761 ATGTGTTTGGTCATTGATATTGG - Intergenic
1118515013 14:66517859-66517881 ATGTTTCAGGACATTGGTCTGGG + Intronic
1120401463 14:84037849-84037871 CTGTGTCTGGATATTCATCTGGG - Intergenic
1121905806 14:97741682-97741704 CTGTTTCTAGTCAGCCATCTTGG + Intergenic
1122178696 14:99939175-99939197 CTGTTTGTGGTCTTTGTTTTAGG + Exonic
1123199666 14:106650578-106650600 CTGTTTTTGGACATGGATCTGGG + Intergenic
1124634637 15:31357314-31357336 CTGTCTCTGCTCCTTGGTCTGGG + Intronic
1125345522 15:38714969-38714991 CTGATGCTGGTTAGTGATCTCGG - Intergenic
1126064490 15:44815753-44815775 CTGCTTCTAGTCAGTCATCTTGG - Intergenic
1126213162 15:46122924-46122946 AAGTTTCTTGACATTGATCTGGG - Intergenic
1126953752 15:53911259-53911281 CTGTTCCTGGCTATTTATCTGGG - Intergenic
1127956766 15:63860541-63860563 CTGGTTCTGCTCTTTGATCCAGG - Intergenic
1128690891 15:69724031-69724053 CTGATTAGGGCCATTGATCTTGG + Intergenic
1132387475 15:101410655-101410677 CTGTTTCTGGCCACTGGGCTTGG + Intronic
1134853081 16:17497952-17497974 CTGTTTCTGCTCCTTGATTCTGG + Intergenic
1135304627 16:21357411-21357433 CTGGTTCTGGTCATGGCTCCAGG + Intergenic
1136301370 16:29336538-29336560 CTGGTTCTGGTCATGGCTCCAGG + Intergenic
1136661994 16:31771441-31771463 CTGTTTCTAGTCAGCTATCTTGG - Intronic
1138420805 16:56897929-56897951 CCGTTGCTGGTCCCTGATCTTGG - Intronic
1140657481 16:77155530-77155552 GGGTTTCTGGTCATTCTTCTGGG - Intergenic
1141667250 16:85472199-85472221 CAGTTTATGGTCATTTATCATGG - Intergenic
1142063067 16:88043235-88043257 CTGGTTCTGGTCATGGCTCCAGG + Intronic
1142916483 17:3143149-3143171 CTGTTTCTAGTCAGCCATCTTGG + Intergenic
1144102099 17:11950801-11950823 TTGTTTCTGGTCATTTCCCTGGG - Intronic
1147985864 17:44307774-44307796 CTGAATGGGGTCATTGATCTCGG - Intergenic
1153757691 18:8300643-8300665 CTGTTTCTGGGCATTGCGGTGGG + Intronic
1155847146 18:30722393-30722415 CTGTTTCTGGAGATTTATTTTGG + Intergenic
1157936128 18:51874702-51874724 CTGTTCTTGGTCCTTGGTCTGGG + Intergenic
1158677088 18:59529779-59529801 CTGTTTCTGGTCATTGATCTTGG + Intronic
1159243229 18:65770983-65771005 CAGTTTCTGGTGAGTGCTCTTGG + Intronic
1159519635 18:69501951-69501973 CTGTTACAGATCATTGTTCTGGG - Intronic
1159626825 18:70704775-70704797 GTGTATCTGGTCAGGGATCTGGG + Intergenic
1160606467 18:80054116-80054138 ATCCTTCTGGTCATTGGTCTAGG + Intronic
1164392317 19:27835635-27835657 TTGTTTGTAGTCATTGTTCTTGG - Intergenic
1165811299 19:38613680-38613702 CCTTTTCTGGCCATTGCTCTCGG - Intronic
1166341963 19:42143459-42143481 CTGTTTCTGGGCAGTGAAATGGG - Intronic
1167957558 19:53078815-53078837 GTGTTCCTGGTCTTTGTTCTAGG - Intronic
926916787 2:17900123-17900145 CTGGTTCTCTGCATTGATCTTGG + Intronic
928319408 2:30271222-30271244 CTGTTTCTCATCATTGAACAGGG - Intronic
929084155 2:38151543-38151565 ATGCTTCAGGACATTGATCTAGG + Intergenic
929185149 2:39086330-39086352 CTGTATCTGGCCAGTGATCTGGG - Intronic
931883593 2:66592039-66592061 ATTTTCCTGGTCATTGTTCTTGG + Intergenic
932998559 2:76890060-76890082 TTATTTCTTTTCATTGATCTTGG - Intronic
933260243 2:80124207-80124229 CAGTGTCTGGACATAGATCTGGG - Intronic
933625171 2:84589977-84589999 CACTTTCTGGTCATCCATCTGGG - Intronic
934623520 2:95831062-95831084 CTGCTTCTAGTCAGTCATCTTGG - Intergenic
934923840 2:98367502-98367524 CTGTTTCTAGTCAGCCATCTTGG + Intronic
935794726 2:106630111-106630133 CTGTTTCTGCTGATGGATTTTGG + Intergenic
936861821 2:117028767-117028789 CTGTTTCTAATCAATCATCTTGG - Intergenic
938000765 2:127734355-127734377 CTGTCACTGGTCATTTAGCTAGG - Intronic
938098576 2:128480009-128480031 GTGTTTTTAGTCATTGCTCTAGG - Intergenic
938784805 2:134617274-134617296 GTGTTTCTTGTGATTGCTCTAGG - Intronic
939080199 2:137651050-137651072 CCGTTTCTGGTCTTGGATCAGGG + Intronic
939391002 2:141570091-141570113 CTGCTTCTAGTCAGTCATCTCGG - Intronic
940731126 2:157393821-157393843 ATGTTTATTATCATTGATCTTGG - Intergenic
941135338 2:161710307-161710329 CTGTTTCTTGGCATTGCTTTGGG + Intronic
942869298 2:180715718-180715740 CTGATTCTGGTCACTGAGTTGGG - Intergenic
943970526 2:194399507-194399529 ATGCTTCAGGACATTGATCTGGG - Intergenic
944864145 2:203844592-203844614 CTGTTTTTATTCATTGATTTTGG - Intergenic
944902630 2:204231197-204231219 CTGGTTCTGGTGATTGGTTTAGG + Intergenic
946760350 2:222987683-222987705 GTGTTTCTGTTCCTTGGTCTGGG + Intergenic
947309187 2:228781792-228781814 CTGTTTCTGGGAGTTGATCTAGG - Intergenic
947547519 2:231020933-231020955 CTGTCTCTGGGCATTGCCCTTGG + Intronic
948254388 2:236555445-236555467 CTGGTCATGGTGATTGATCTAGG + Intergenic
1170447905 20:16448636-16448658 CTGTTTATGGTCATTGATGTTGG - Intronic
1170568255 20:17618614-17618636 CTGTTTCTGGGCTTCGCTCTTGG + Exonic
1171514663 20:25719787-25719809 CTGTTCCTGTTCAGTCATCTTGG + Intergenic
1174307029 20:49620488-49620510 CTGTTTCAGGTCACTGCTCCTGG + Intergenic
1174953437 20:55067708-55067730 CTGCTTCTGGTCGGTCATCTTGG + Intergenic
1174992213 20:55523108-55523130 CTGTTTCTAGTCAGCCATCTTGG - Intergenic
1177294330 21:19155332-19155354 ATATTTCTGGTCATTGACCTTGG - Intergenic
1177633190 21:23752752-23752774 CTGTTTCTTCTCTTTGTTCTTGG + Intergenic
1179346531 21:40562846-40562868 CTGTCTCTGGTCCTTTTTCTAGG - Intronic
1180064625 21:45406037-45406059 CGGCTTCTGGGCATTGTTCTCGG - Intronic
1180207876 21:46273445-46273467 CTCCTTCTGGTCCATGATCTGGG + Exonic
1180598425 22:16995809-16995831 CTGTTTTTGGTCTTTGATGTTGG - Intronic
1181804672 22:25367549-25367571 CTGTTTTTGGTCATTGTGTTGGG - Intronic
1183786856 22:40034329-40034351 CTGGTTCTGCTCACTGAGCTGGG - Exonic
949311276 3:2701283-2701305 CTGATTATGGTTACTGATCTTGG + Intronic
949465951 3:4344073-4344095 CTGCTTCTAGTCAGTCATCTTGG - Intronic
950798565 3:15531244-15531266 CTGTGTCTGGTCCTGGAGCTGGG - Intergenic
950832601 3:15890109-15890131 CTCTTGCTGGTCATTTCTCTTGG + Intergenic
951957838 3:28276219-28276241 CTGTTTCTAGTCAGCCATCTTGG + Intronic
951991713 3:28682779-28682801 CTGTTTCTTGAGATTGTTCTTGG + Intergenic
953285767 3:41607023-41607045 ATGCTTCAGGACATTGATCTAGG - Intronic
955622812 3:60883780-60883802 ATGCTTCTGGGCATTGGTCTGGG + Intronic
956158060 3:66318606-66318628 CTGTTTCTGTTCAGCCATCTTGG + Intronic
956237679 3:67092769-67092791 CTGTTTCTGGAAATTCATTTGGG - Intergenic
956552195 3:70473952-70473974 CTGCTTCTGGTGATGGATGTGGG - Intergenic
957394634 3:79621913-79621935 CTGTTTCTAGTCAGCCATCTTGG - Intronic
960350673 3:116589103-116589125 CTGTTACTGCTCATACATCTGGG - Intronic
960357641 3:116673284-116673306 CGCTTTCTGGTCAGTGATCTTGG + Intronic
960446055 3:117749988-117750010 CTGTTTCTGTCCATTCCTCTTGG + Intergenic
960685007 3:120286917-120286939 CTGCTTCTGGTCAGCCATCTTGG - Intergenic
961094847 3:124145380-124145402 CTTTTTAATGTCATTGATCTGGG - Intronic
961955515 3:130798694-130798716 ACTTTTCTGGACATTGATCTAGG + Intergenic
961963352 3:130876199-130876221 ATGCTTCTGGACATTGGTCTAGG - Intronic
961983426 3:131105108-131105130 CTGCTTCTAGTCAGTCATCTTGG + Intronic
962691808 3:137906972-137906994 CTGTTTCTAGTCAGCCATCTTGG - Intergenic
963551225 3:146726469-146726491 CTATTTTTGGTCTTTGATGTTGG - Intergenic
964435046 3:156642633-156642655 CTGTTCATGGCCATTGATATTGG - Intergenic
964458401 3:156894056-156894078 CTGTTTCAGGTGATTGCTTTTGG - Intronic
964753821 3:160076858-160076880 CTGTCTCTGAACATTGGTCTGGG - Intergenic
965160390 3:165125701-165125723 CTGTGTCCGGTCTTTGATCCAGG + Intergenic
965385292 3:168038526-168038548 TTGGTTCTGGTCATTGATTTTGG + Intronic
965956224 3:174373223-174373245 GTGTTTCAGGACGTTGATCTGGG + Intergenic
966515205 3:180812510-180812532 CTGTCTCTGGTCTCTGATTTGGG + Intronic
966539743 3:181075759-181075781 CTGTTTCTAGTCAGCCATCTTGG + Intergenic
966551555 3:181210602-181210624 CTGCTTCTGTTCATTCAACTGGG - Intergenic
968679772 4:1909351-1909373 CTGGTTGTGTTCATTGCTCTGGG + Intronic
971286166 4:25291786-25291808 CTGTTTCTAGTCAGCCATCTTGG + Intergenic
973868222 4:55136306-55136328 CTGCTTCTGGTAATTGGTTTAGG - Intergenic
974184871 4:58431923-58431945 CTGCTTCTAGTCAGTCATCTTGG + Intergenic
974913421 4:68149764-68149786 CTGTTTCTAGTCAGCCATCTTGG + Intergenic
975704476 4:77098421-77098443 CTGTTTATTGCCCTTGATCTAGG + Intergenic
975857926 4:78644213-78644235 CTGCTTCTGGTCTTTAGTCTTGG - Intergenic
976375560 4:84341921-84341943 CTGTTTCTAGTCAGTCATCTTGG - Intergenic
976583517 4:86767909-86767931 CTTTTTCTGGGCCTTGACCTTGG - Exonic
976940369 4:90694087-90694109 CTCTTTCTGGTCATTTATCCTGG - Intronic
978197043 4:105984200-105984222 CTGCTTTTGGTCTTTGATGTTGG + Intronic
978230526 4:106392241-106392263 CTCTTTCTGGTCCTTGCTGTAGG + Intergenic
978349151 4:107803131-107803153 ATCTTTATGGTCCTTGATCTTGG + Intergenic
979462799 4:121002586-121002608 CAGCTTCTGGATATTGATCTGGG - Intergenic
979732926 4:124045948-124045970 CTGTTTCTAGTCAGTTATCTTGG + Intergenic
980439321 4:132819277-132819299 TTCTTTCTGTTCATTGCTCTAGG - Intergenic
981882527 4:149632033-149632055 CTGCTTCTGTTCATTCACCTAGG - Intergenic
982372198 4:154646737-154646759 CTGCTTCTGGTCAGCCATCTTGG - Intronic
982577747 4:157137094-157137116 TTGTTTCAGTTCATTGATGTAGG + Intronic
983745903 4:171199817-171199839 CTTTTTCTGGACATTGGCCTAGG + Intergenic
985708783 5:1416417-1416439 CTGTCTGTGTTCATTGATCTGGG + Intronic
987797129 5:22641979-22642001 CAGTTTCTGTGCATTGAGCTTGG - Intronic
987883833 5:23786674-23786696 CTGTTTCTACCCATTCATCTTGG + Intergenic
988325615 5:29762881-29762903 ATGCTTCTGGACCTTGATCTTGG + Intergenic
988642856 5:33060600-33060622 CTTTTTCTGTTCTGTGATCTAGG - Intergenic
988772470 5:34446948-34446970 CTGCTTTTGGTCTTTGATGTTGG + Intergenic
989687501 5:44107670-44107692 CTATTTTTGGTCTTTGATGTTGG + Intergenic
990931451 5:61095974-61095996 CTGTTTCTAGTCGTCCATCTTGG + Intronic
991249738 5:64546309-64546331 CTCTGTCTGTTCATTAATCTTGG - Intronic
991497026 5:67236763-67236785 CAGTTTCTGATCATTCAACTGGG - Intergenic
992257865 5:74939658-74939680 ATTCTTCTGGGCATTGATCTAGG + Intergenic
992571569 5:78064913-78064935 CTGTTTCTAGTCAGTCATCTTGG - Intronic
994344053 5:98664214-98664236 CTGTTTCTAGTCAGCCATCTTGG - Intergenic
994350592 5:98742098-98742120 CTGTTTCTAGTCATCCCTCTTGG - Intergenic
994473553 5:100239348-100239370 CTGCTTCTGGTCAGCCATCTTGG + Intergenic
994636663 5:102352297-102352319 CTGCTTTTGGTCTTTGATGTTGG - Intergenic
995013585 5:107285596-107285618 CTGTTACTGGTCAATTTTCTAGG + Intergenic
996041384 5:118816850-118816872 ATGCTTCAGGTCATTGGTCTAGG + Intergenic
997658942 5:135575591-135575613 CTGTTACTAGTCATTGGTCATGG + Intronic
998181119 5:139943519-139943541 CTGTTTCTTGTCTGTGAGCTGGG + Intronic
999268265 5:150280960-150280982 CTGTGTCTGTGCATTGTTCTGGG + Intronic
1000231314 5:159317863-159317885 CTGATGTTGGTCATTGATCTTGG - Intronic
1002494672 5:179603593-179603615 CTGCTTCTGGTGAGTGCTCTCGG - Intronic
1002680363 5:180957620-180957642 ATGCTTCAGGACATTGATCTGGG - Intergenic
1002815136 6:672807-672829 CAGTTTCTGGTCAGAGATGTAGG - Intronic
1004773067 6:18808693-18808715 CTTTTTCTGTTCATTTTTCTAGG + Intergenic
1006548885 6:34803835-34803857 CTGCTTCTGGTCATCTGTCTCGG + Intronic
1007195240 6:40055028-40055050 CTGTTTCTAGTCAGCCATCTTGG - Intergenic
1007215455 6:40234202-40234224 CTGTTTCTAGTAAGTCATCTTGG - Intergenic
1008032300 6:46710597-46710619 CTGATTCTTGACATTGATCATGG - Exonic
1008239538 6:49092465-49092487 ATGTTTCAGGACATTGATCTAGG - Intergenic
1009231691 6:61070808-61070830 CTGTTTCTGGTCAGGGATTCAGG - Intergenic
1011321074 6:86094484-86094506 CTGTTTCTAGTCAGCCATCTTGG - Intergenic
1011446773 6:87449897-87449919 ATGTTTCAGGGCATTGGTCTGGG - Intronic
1012314962 6:97774607-97774629 CTGTTTCTAGTCAGCCATCTTGG - Intergenic
1012838622 6:104301154-104301176 CTGTTTCTTTTCATTGCACTTGG - Intergenic
1013671604 6:112409111-112409133 TGGTTACTGGTTATTGATCTCGG - Intergenic
1014498413 6:122156440-122156462 TTATTTATGGTTATTGATCTGGG - Intergenic
1015597993 6:134884175-134884197 ATGCTTCAGGACATTGATCTGGG + Intergenic
1015660300 6:135566978-135567000 CTGCTTCTAGTCATCCATCTTGG + Intergenic
1015939335 6:138432485-138432507 CTGACTCTGGACATGGATCTGGG - Exonic
1016234304 6:141844206-141844228 ATGTTTCAGGGCATTGGTCTAGG - Intergenic
1016596317 6:145805503-145805525 CTGATTCTGGTCTATGACCTGGG + Exonic
1016935240 6:149445035-149445057 CTGTTTCTGGGCATTGGGATAGG + Intergenic
1017889711 6:158628202-158628224 CTGCTTCTGGTTTTTGGTCTCGG - Intronic
1018157969 6:161007124-161007146 TTGTTTCTGGTCTGTGACCTGGG - Intronic
1018567174 6:165166652-165166674 ATGTTGCTGGACATTGATCCAGG - Intergenic
1019464651 7:1180954-1180976 CTGTTTCTTCTCATAAATCTAGG - Intergenic
1020884470 7:13804409-13804431 CTGCCTTTGGTCATTGATGTTGG - Intergenic
1021434851 7:20602419-20602441 ACATTTGTGGTCATTGATCTAGG - Intergenic
1021776409 7:24059284-24059306 CTGTTTCTAGTCAGCCATCTTGG - Intergenic
1023476437 7:40584146-40584168 ATGTTTCTTCTCATTGATGTGGG + Intronic
1025041587 7:55650789-55650811 CTGTTTCTAGTCAGCCATCTTGG - Intergenic
1025861965 7:65338736-65338758 CTGTGTCTAGTCAGTCATCTTGG - Intergenic
1026623966 7:71976099-71976121 TTATTTCTGGTCACTGGTCTTGG + Intronic
1027377550 7:77567721-77567743 CTCTTTCTGATCTTTGATCTAGG + Intronic
1029792268 7:102857151-102857173 ATGCTTCAGGGCATTGATCTTGG + Intronic
1030208180 7:106970860-106970882 GTGTTTCTGATGATTTATCTTGG - Intergenic
1032307523 7:130750286-130750308 TTGTTTCTGGTTTTTGATTTTGG - Intergenic
1032776697 7:135121639-135121661 CTGTTTCTAGTCAGCCATCTTGG - Intronic
1033561236 7:142534001-142534023 CTGTTTTTAGTATTTGATCTGGG - Intergenic
1034070974 7:148184620-148184642 GTGTTTCTGGTCATAAATCCAGG - Intronic
1034132667 7:148734797-148734819 AGGTTTCTGTTCATTGTTCTGGG + Intronic
1034952513 7:155309199-155309221 GTGTTTCTAGTCAATGATATTGG + Exonic
1035278045 7:157759654-157759676 CTGTTATTGGTCAATGATGTTGG + Intronic
1037179490 8:15987762-15987784 ATGTTTCAGGACATTGTTCTAGG - Intergenic
1038184992 8:25264941-25264963 CTGTGTCTGATAATTAATCTTGG + Intronic
1038184998 8:25265002-25265024 CTGTGTCTGGTAATTAATCTTGG + Intronic
1038185004 8:25265063-25265085 CTGTGTCTGATAATTAATCTTGG + Intronic
1038185011 8:25265124-25265146 CTGTGTCTGGTAATTAATCTTGG + Intronic
1039402122 8:37278965-37278987 CTGTTTCTAGTCAGCCATCTTGG - Intergenic
1042187170 8:66148341-66148363 CTGTATCTGGTCTATGCTCTTGG - Intronic
1042373819 8:68024805-68024827 GTGTTTTTGGTGATTGCTCTAGG + Intronic
1042629845 8:70804989-70805011 CTGTTTCTAGTCTGCGATCTTGG - Intergenic
1044955461 8:97475487-97475509 CTGCTTCTAGTCCTGGATCTGGG - Intergenic
1046702601 8:117418367-117418389 CTGTTTCTAGTCAACCATCTTGG - Intergenic
1047561603 8:125992630-125992652 TTGTTTATGGTAATTGATATAGG - Intergenic
1048257978 8:132920004-132920026 ATGTAACTGGTCTTTGATCTTGG + Intronic
1048537372 8:135309944-135309966 CTGTTTTTCCTGATTGATCTTGG + Intergenic
1048705757 8:137151434-137151456 CTGGTTCTGTTCATTCATCTTGG + Intergenic
1048911444 8:139139317-139139339 CTGTCTCTGGTCCTTGATTCAGG - Intergenic
1050300385 9:4252751-4252773 CTGTCTTTGGTCTTTGATGTTGG + Intronic
1050781655 9:9343883-9343905 CTGTTTCTTCTCATTGGTATTGG - Intronic
1052262442 9:26532985-26533007 ATGTTTCATGACATTGATCTGGG + Intergenic
1052546541 9:29888326-29888348 CTGTTTCTAGTCAGCCATCTTGG - Intergenic
1052665134 9:31486707-31486729 CTGCTTCTAGCCATTCATCTTGG - Intergenic
1056715989 9:89029293-89029315 CTTTTTCTATTCATTGTTCTAGG - Intronic
1056996121 9:91461087-91461109 TTGTTCCTGGTCATTGATTTTGG + Intergenic
1057125323 9:92611733-92611755 CTGTTTCTTCTCATTGCTTTGGG - Intronic
1057910934 9:99020289-99020311 CTGGTCCTGGTCAGTGAGCTGGG - Intronic
1058352824 9:104046514-104046536 ATCCTTCTGGACATTGATCTAGG + Intergenic
1058615146 9:106818310-106818332 CTGATGCTGGTCCATGATCTGGG + Intergenic
1060653066 9:125347401-125347423 CTTTTTCTCTTCATTTATCTTGG - Intronic
1062304418 9:135895150-135895172 CTGTTTCTCCTCTTTGATCTGGG - Intronic
1186736211 X:12467202-12467224 CAGTTTATGATCATAGATCTTGG + Intronic
1187620425 X:21047216-21047238 CTGTTTCTGTTCAGCTATCTTGG - Intergenic
1187784428 X:22867663-22867685 CTGTCTTTGGTCTTTGATGTTGG - Intergenic
1187847489 X:23555685-23555707 CTATTTGTGGGCATTGTTCTAGG - Intergenic
1188092037 X:25976483-25976505 CTGTTTCTAGTCAGCTATCTTGG - Intergenic
1188273427 X:28172185-28172207 CTGTTGCTGGACACTTATCTTGG + Intergenic
1192878708 X:75259121-75259143 CTCTTTTTGGTCTTTGATGTCGG - Intergenic
1192951833 X:76025852-76025874 CTGTTTCTCGTCAGCCATCTTGG - Intergenic
1193400410 X:81036177-81036199 CTGTTTCTGGGCTTTGTTTTGGG - Intergenic
1193696006 X:84708290-84708312 CTGTTTCTCGTATTTGCTCTTGG + Intergenic
1193846210 X:86474429-86474451 CTTCTTCAGGACATTGATCTGGG - Intronic
1194420047 X:93661710-93661732 CTATTTTTGGTCTTTGATGTTGG - Intergenic
1194635841 X:96343751-96343773 CTGCTTCTGGTCAGCTATCTTGG + Intergenic
1195483720 X:105377929-105377951 CTTTTTATAGTCATTTATCTGGG - Intronic
1196244587 X:113385661-113385683 CTGTTTCTGTTAATTCATTTAGG + Intergenic
1196309246 X:114142588-114142610 TTGTTTCTACTCATTAATCTGGG - Intergenic
1196517380 X:116629184-116629206 CTGCTTCTAGTCAGTCATCTTGG + Intergenic
1197073650 X:122329983-122330005 ATTTTTCTGGACATTGGTCTAGG + Intergenic
1197105546 X:122709759-122709781 ATGTTTCAGGACATTGGTCTGGG + Intergenic
1197367776 X:125586067-125586089 CTATTTCTGGACATGTATCTCGG - Intergenic
1197892645 X:131281596-131281618 ATCTTTCTGGGCACTGATCTGGG + Intronic
1198303222 X:135351388-135351410 AGGTTTCTGGCCATTGAACTGGG + Intronic
1198841231 X:140860447-140860469 CTGTTTCTAGTCAGCCATCTTGG - Intergenic
1199248799 X:145636804-145636826 CTGCTTCTTGTCAGTCATCTTGG - Intergenic
1199732575 X:150650944-150650966 CTGTTTCTGGGCCTTTGTCTAGG + Intronic