ID: 1158678306

View in Genome Browser
Species Human (GRCh38)
Location 18:59543031-59543053
Sequence AGAATCTAAGTTATACTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158678306_1158678312 13 Left 1158678306 18:59543031-59543053 CCAACAAGTATAACTTAGATTCT No data
Right 1158678312 18:59543067-59543089 GCTTCCTTCTCGGGAAGCCTTGG No data
1158678306_1158678307 -9 Left 1158678306 18:59543031-59543053 CCAACAAGTATAACTTAGATTCT No data
Right 1158678307 18:59543045-59543067 TTAGATTCTCCTCCAAATTTTGG No data
1158678306_1158678310 3 Left 1158678306 18:59543031-59543053 CCAACAAGTATAACTTAGATTCT No data
Right 1158678310 18:59543057-59543079 CCAAATTTTGGCTTCCTTCTCGG No data
1158678306_1158678311 4 Left 1158678306 18:59543031-59543053 CCAACAAGTATAACTTAGATTCT No data
Right 1158678311 18:59543058-59543080 CAAATTTTGGCTTCCTTCTCGGG No data
1158678306_1158678314 27 Left 1158678306 18:59543031-59543053 CCAACAAGTATAACTTAGATTCT No data
Right 1158678314 18:59543081-59543103 AAGCCTTGGATTGCTCTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158678306 Original CRISPR AGAATCTAAGTTATACTTGT TGG (reversed) Intronic