ID: 1158678307

View in Genome Browser
Species Human (GRCh38)
Location 18:59543045-59543067
Sequence TTAGATTCTCCTCCAAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158678306_1158678307 -9 Left 1158678306 18:59543031-59543053 CCAACAAGTATAACTTAGATTCT No data
Right 1158678307 18:59543045-59543067 TTAGATTCTCCTCCAAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158678307 Original CRISPR TTAGATTCTCCTCCAAATTT TGG Intronic