ID: 1158678308

View in Genome Browser
Species Human (GRCh38)
Location 18:59543054-59543076
Sequence AGAAGGAAGCCAAAATTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158678308_1158678312 -10 Left 1158678308 18:59543054-59543076 CCTCCAAATTTTGGCTTCCTTCT No data
Right 1158678312 18:59543067-59543089 GCTTCCTTCTCGGGAAGCCTTGG No data
1158678308_1158678314 4 Left 1158678308 18:59543054-59543076 CCTCCAAATTTTGGCTTCCTTCT No data
Right 1158678314 18:59543081-59543103 AAGCCTTGGATTGCTCTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158678308 Original CRISPR AGAAGGAAGCCAAAATTTGG AGG (reversed) Intronic