ID: 1158678312 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:59543067-59543089 |
Sequence | GCTTCCTTCTCGGGAAGCCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1158678308_1158678312 | -10 | Left | 1158678308 | 18:59543054-59543076 | CCTCCAAATTTTGGCTTCCTTCT | No data | ||
Right | 1158678312 | 18:59543067-59543089 | GCTTCCTTCTCGGGAAGCCTTGG | No data | ||||
1158678306_1158678312 | 13 | Left | 1158678306 | 18:59543031-59543053 | CCAACAAGTATAACTTAGATTCT | No data | ||
Right | 1158678312 | 18:59543067-59543089 | GCTTCCTTCTCGGGAAGCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1158678312 | Original CRISPR | GCTTCCTTCTCGGGAAGCCT TGG | Intronic | ||