ID: 1158678312

View in Genome Browser
Species Human (GRCh38)
Location 18:59543067-59543089
Sequence GCTTCCTTCTCGGGAAGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158678308_1158678312 -10 Left 1158678308 18:59543054-59543076 CCTCCAAATTTTGGCTTCCTTCT No data
Right 1158678312 18:59543067-59543089 GCTTCCTTCTCGGGAAGCCTTGG No data
1158678306_1158678312 13 Left 1158678306 18:59543031-59543053 CCAACAAGTATAACTTAGATTCT No data
Right 1158678312 18:59543067-59543089 GCTTCCTTCTCGGGAAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158678312 Original CRISPR GCTTCCTTCTCGGGAAGCCT TGG Intronic