ID: 1158678314

View in Genome Browser
Species Human (GRCh38)
Location 18:59543081-59543103
Sequence AAGCCTTGGATTGCTCTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158678309_1158678314 1 Left 1158678309 18:59543057-59543079 CCAAATTTTGGCTTCCTTCTCGG No data
Right 1158678314 18:59543081-59543103 AAGCCTTGGATTGCTCTAGTTGG No data
1158678306_1158678314 27 Left 1158678306 18:59543031-59543053 CCAACAAGTATAACTTAGATTCT No data
Right 1158678314 18:59543081-59543103 AAGCCTTGGATTGCTCTAGTTGG No data
1158678308_1158678314 4 Left 1158678308 18:59543054-59543076 CCTCCAAATTTTGGCTTCCTTCT No data
Right 1158678314 18:59543081-59543103 AAGCCTTGGATTGCTCTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158678314 Original CRISPR AAGCCTTGGATTGCTCTAGT TGG Intronic