ID: 1158679661

View in Genome Browser
Species Human (GRCh38)
Location 18:59555903-59555925
Sequence AAACCCACAGCTCAGGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158679657_1158679661 17 Left 1158679657 18:59555863-59555885 CCAATTCTGTTTGTTATAAATGA 0: 1
1: 0
2: 2
3: 53
4: 498
Right 1158679661 18:59555903-59555925 AAACCCACAGCTCAGGAGATTGG 0: 1
1: 0
2: 1
3: 17
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158679661 Original CRISPR AAACCCACAGCTCAGGAGAT TGG Intronic
900229601 1:1549853-1549875 AATCCCACTGCTCAGGAGGCTGG + Intronic
900490071 1:2943651-2943673 AAATCCACACATCAGGAAATTGG + Intergenic
900723831 1:4201577-4201599 AAACCCTCTGCTCAGAAGTTTGG + Intergenic
903022386 1:20403406-20403428 TAACCCACTTCTCAGGAAATGGG + Intergenic
903677327 1:25072626-25072648 AAGCCCACAGCTCAGGTGTGAGG + Intergenic
903848943 1:26294935-26294957 AAAGGAACAGCCCAGGAGATGGG - Intronic
905184649 1:36187776-36187798 GATCCCACAGCTCAGGAAAGAGG + Intergenic
905346598 1:37315245-37315267 AAAGCCAGAGCTCAGGGGGTGGG - Intergenic
906648831 1:47495801-47495823 AGCTCCACATCTCAGGAGATTGG - Intergenic
907052678 1:51340303-51340325 AAGGCCACAACTCAGGAGAGTGG + Intronic
912557581 1:110527337-110527359 AAACCCATATTTCAGGGGATGGG - Intergenic
916519171 1:165548079-165548101 ATATCCACATTTCAGGAGATAGG + Intronic
917948218 1:179999456-179999478 AAATCCACTGCTTAGGACATCGG - Intronic
918731897 1:188008933-188008955 AAACCAACAGCTTTAGAGATGGG - Intergenic
919044639 1:192435396-192435418 ACACTCACAGCTAAGGAGAGGGG + Intergenic
922085439 1:222342364-222342386 GAACACAGAGCTCAGGAGAAGGG + Intergenic
924424907 1:243941965-243941987 AAAAGCACAGCCCAGGAGAAGGG - Intergenic
1063185346 10:3645528-3645550 AAACCCTCAGTTCCGGAAATTGG - Intergenic
1063197465 10:3756955-3756977 AAACCCACACCCCAAGAGAATGG + Intergenic
1063661336 10:8036635-8036657 AACCCCAGTGCTCAGCAGATGGG - Intergenic
1064324598 10:14338315-14338337 AAACCCACACCCATGGAGATAGG + Intronic
1065508819 10:26457133-26457155 ACACTCACAGCACAGGAGCTAGG + Intronic
1065687231 10:28298456-28298478 AGACCCACTGCTCAGAAGAAAGG - Intronic
1068787808 10:60996040-60996062 CAATTCACAACTCAGGAGATGGG + Intronic
1069601146 10:69708896-69708918 AAACCCAAAGGTGATGAGATGGG - Intergenic
1074922634 10:118032634-118032656 AAAACCACAGATAAGGGGATGGG - Intronic
1076204787 10:128588468-128588490 CCACTCACAGCCCAGGAGATGGG - Intergenic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1076794062 10:132790350-132790372 CACCCTCCAGCTCAGGAGATGGG - Intergenic
1077028937 11:454893-454915 AAACGCAAAGCTCAAGGGATGGG - Intronic
1077161295 11:1113768-1113790 AAGCCTACAGCAGAGGAGATAGG + Intergenic
1077910754 11:6569907-6569929 GAACCCGAAGCTCAGGAGAGAGG + Intronic
1078422021 11:11220343-11220365 GAACTCACATCCCAGGAGATGGG - Intergenic
1080284003 11:30586858-30586880 AAAGCCTCAGATCAGCAGATGGG - Intronic
1080645538 11:34185019-34185041 TGGCCCACAGCTCAGCAGATAGG - Intronic
1082946640 11:58768454-58768476 AAACCAACAGGTCAAGAGCTGGG + Intergenic
1083037919 11:59657492-59657514 AAGCACACAGCCCAGGATATTGG - Intronic
1085844339 11:80048604-80048626 AAACCCACTTCTCATGAGAAGGG + Intergenic
1089146191 11:116331119-116331141 AAACCCAGGTCTCCGGAGATGGG + Intergenic
1091339516 11:134799390-134799412 GAGCCCGCAGCTCAGAAGATGGG - Intergenic
1091754176 12:3040975-3040997 AAACCCACCCCCCAGGGGATGGG - Intergenic
1091785941 12:3243525-3243547 AAGCCCTGAGCCCAGGAGATAGG + Intronic
1091846443 12:3659735-3659757 ACACCCACAGCTCCAGAGTTGGG - Intronic
1091900738 12:4142058-4142080 AAACCCAGAGCTAGGGTGATGGG - Intergenic
1092971231 12:13697188-13697210 ACTCCCACAACTCAGGAGAGAGG + Intronic
1093496216 12:19761343-19761365 AAACCAACAGCACAGGAAAAAGG + Intergenic
1095480321 12:42628195-42628217 AAACCCACAGGTCAGAATATCGG - Intergenic
1095991188 12:48035702-48035724 CAACCCAGAGCTCAGGACACAGG + Intergenic
1096599265 12:52717899-52717921 AAGCCACCAGCTCAGGAGAGGGG + Intergenic
1097050455 12:56220180-56220202 AAACCCTGACCTCAGGTGATTGG - Intronic
1097062264 12:56294248-56294270 AACCCCTCACCTCAGGTGATCGG - Intronic
1099556574 12:84115758-84115780 ACACCGATAGCTCAGGGGATGGG + Intergenic
1101166414 12:102038717-102038739 AAGCCTAGAGCTCAGGATATTGG - Intronic
1101714756 12:107300995-107301017 CAACCCCAAGCTCAGGAGATTGG - Intergenic
1101734942 12:107456250-107456272 AAGCCCATAGCTCAGGGGTTGGG - Intronic
1103485365 12:121279288-121279310 AACCCCAGAGCTCAGCAGAGAGG + Intronic
1104463728 12:128974087-128974109 ACACGCACAGATCAAGAGATGGG - Intronic
1106337197 13:28795083-28795105 AATATCACAGCTTAGGAGATGGG + Intergenic
1109252613 13:60038077-60038099 AAACCCAAAACTCAGGATAGTGG + Intronic
1109552892 13:63928511-63928533 AAAACCACAGATCAGGAAATAGG - Intergenic
1114895090 14:26979360-26979382 AAATCCACATCTCAGGCAATTGG + Intergenic
1117739052 14:58797137-58797159 AAAACCACAGCTCACCATATGGG - Intergenic
1117773380 14:59157208-59157230 ATCCCCAGAGATCAGGAGATTGG - Intergenic
1120012726 14:79435718-79435740 ATAGCCTGAGCTCAGGAGATTGG - Intronic
1121284163 14:92721810-92721832 CAACCCACTACTCAGGTGATGGG + Intronic
1121329874 14:93043248-93043270 GATCACACAGCTAAGGAGATCGG + Intronic
1121334357 14:93068428-93068450 AAAGCCACTGCCCAGGATATGGG + Intronic
1121445091 14:93973725-93973747 ACACTCACAGCTCAGGACACAGG + Intronic
1122520146 14:102337802-102337824 AACCCCACAGAGCATGAGATGGG - Intronic
1124657296 15:31518629-31518651 ACACCCACAGCACAGTAGGTGGG + Intronic
1124955426 15:34357067-34357089 AAACACACAGGTCAGCAGACAGG + Exonic
1126262903 15:46715129-46715151 AAACTCTCCGCTCAGCAGATTGG + Intergenic
1126874620 15:53027287-53027309 AAATGCACATCTCAGGAGGTGGG - Intergenic
1127007560 15:54587534-54587556 AAACTCACAACTAAGGAGTTTGG + Intronic
1130222472 15:82032037-82032059 AAAACCACAGCCCTGGAGCTGGG + Intergenic
1130692311 15:86093633-86093655 AAACGAACAGCTCAATAGATAGG + Intergenic
1130780435 15:87032421-87032443 AAACTCAAAGCACAGGAGCTGGG + Intergenic
1130850574 15:87789859-87789881 AAACCCACCAGTCAAGAGATTGG + Intergenic
1133241872 16:4419088-4419110 ATATCCACAGCTCAGGAGATGGG + Intronic
1134688942 16:16178369-16178391 CAACCCCCAGCTCAGGAGGCTGG - Intronic
1135293795 16:21262214-21262236 AAGCCCAAAGCACAGGAGAGAGG + Intronic
1136058682 16:27709753-27709775 AAACCCACAGAGCAGGGGCTGGG - Intronic
1136379983 16:29888703-29888725 GAAGCCACAGCTCAGGAGGTAGG + Exonic
1137277759 16:46948030-46948052 AACCCCACAGCACTGCAGATGGG - Intergenic
1139927219 16:70496238-70496260 TACCCCACAGCTCACGAGCTGGG - Intronic
1142279977 16:89142811-89142833 ACACCCACACCTAAGGAGACGGG + Intronic
1143101743 17:4508321-4508343 AAACGCACTGCCCAGGTGATTGG - Intronic
1143943386 17:10567014-10567036 AAACCCACAGCTGAGAACAATGG - Intergenic
1144826061 17:18106343-18106365 ACACCCAAAGCTCAGGACACAGG - Intronic
1145972405 17:28964125-28964147 AAAGTGGCAGCTCAGGAGATAGG + Exonic
1147717222 17:42516570-42516592 AAACCCAGGGCTCAAGAGACAGG - Intronic
1149679641 17:58496348-58496370 ACACCTCCAGGTCAGGAGATGGG + Intronic
1152614562 17:81331783-81331805 AAATCCAGACCTCAGGAGAGGGG - Intergenic
1152696599 17:81800755-81800777 AAACCCACATCTCAGGGGTGGGG + Intergenic
1155342859 18:24830435-24830457 AAACCCACAGCTCAAGAACCAGG - Intergenic
1157726333 18:49966884-49966906 AAAGCCACAGTTGGGGAGATTGG + Intronic
1158679661 18:59555903-59555925 AAACCCACAGCTCAGGAGATTGG + Intronic
1160496548 18:79379354-79379376 CAGCCAGCAGCTCAGGAGATGGG + Intergenic
927292699 2:21420308-21420330 AAACACAAAGCCCAGGAGAATGG + Intergenic
927346092 2:22043030-22043052 AACTCCAGACCTCAGGAGATCGG - Intergenic
927940489 2:27100233-27100255 ATTCCCACAGCTCAGAAGCTGGG + Exonic
928804930 2:35139849-35139871 GAACCCACAGTCCAGGAGTTGGG - Intergenic
930868983 2:56150810-56150832 AAAACATCAGGTCAGGAGATTGG + Intergenic
931518435 2:63069432-63069454 AAACTCACAGCTGAGCAGACAGG + Intergenic
933017323 2:77144711-77144733 TATCACACAGCTCAGGAGCTAGG - Intronic
933730380 2:85451780-85451802 AAACCCAGAGTTCAGGGGACAGG - Intergenic
934649806 2:96084403-96084425 AAACCCACAGCACAGGACAAAGG - Intergenic
935292233 2:101620468-101620490 AAAACCACAGGTCCTGAGATGGG - Intergenic
935358494 2:102226944-102226966 AAACCCACAGCTGTGGTGTTGGG - Intronic
936165214 2:110114954-110114976 ATACGCACAGCTCTGCAGATGGG + Intronic
937570182 2:123348299-123348321 AAAAATACACCTCAGGAGATAGG + Intergenic
937887533 2:126910073-126910095 AAGCCAACAGATCAGGAGACGGG - Intergenic
941104161 2:161333514-161333536 AAACCCAGGGCTCTGGAGTTAGG + Intronic
942116106 2:172730888-172730910 AAACCTACAGATCAGGAGAGAGG + Intergenic
944163797 2:196695219-196695241 ACAACCAGAGGTCAGGAGATGGG + Intronic
945906651 2:215601380-215601402 AAACCCACATTTCAGGAATTTGG - Intergenic
947537316 2:230948311-230948333 AGACCCAGAGGTCAGGAGATGGG - Intronic
948006771 2:234616122-234616144 CAACACACAGCACAGGAGAAAGG + Intergenic
948795567 2:240400569-240400591 GGACCCACAGCCCAGGAGGTGGG + Intergenic
1170829508 20:19827912-19827934 AAGCCTACAGCCCAGGAGAAGGG - Intergenic
1172007730 20:31828983-31829005 AAACCCTCAGCACATCAGATTGG - Intronic
1173124624 20:40325276-40325298 AAAACCAGAGCTCAGAAGACTGG + Intergenic
1173524994 20:43725273-43725295 AACTCCACACCTCAGGTGATTGG + Intergenic
1175310569 20:58008869-58008891 AAAGCCAAAACTCAGGAGATGGG + Intergenic
1175574984 20:60054125-60054147 AAAGCCACAGCCCAGGATGTTGG - Intergenic
1177222681 21:18215305-18215327 AAACTTCCACCTCAGGAGATAGG + Intronic
1179732317 21:43374692-43374714 CCACCCACTGCTCAGGAGCTTGG - Intergenic
1181360291 22:22328952-22328974 AAACCAACAGGCCAGGAGACAGG - Intergenic
952524337 3:34194388-34194410 AAATCCACAGATCAGGCCATAGG - Intergenic
952557846 3:34553633-34553655 GAAGCCACAGCTCAGGGGTTGGG + Intergenic
956463836 3:69499369-69499391 AAAACAACAGCTGAGGAGAAAGG + Intronic
957170807 3:76734476-76734498 AAACCCACAGCTCATAAATTTGG + Intronic
958491381 3:94778334-94778356 AAAAACAAAGCTGAGGAGATGGG - Intergenic
959745554 3:109772389-109772411 CTACACACTGCTCAGGAGATAGG + Intergenic
960399739 3:117181618-117181640 AAAGCCACAAGTGAGGAGATTGG + Intergenic
961383033 3:126508319-126508341 AAACCCACAGCTCAGGATGCAGG - Intronic
962453838 3:135547131-135547153 AGGCCCACTGCTCAGGAGAAGGG - Intergenic
964074173 3:152673062-152673084 AAACCCAAAACTCAGGAATTGGG - Intergenic
965091223 3:164164757-164164779 ACACCCAAAGCCCAGGAAATAGG + Intergenic
965127794 3:164651515-164651537 TAACCCACAGTTCTGGAGGTGGG - Intergenic
966102421 3:176287062-176287084 AAACTCATAGCTCTGGATATTGG + Intergenic
967829985 3:193910242-193910264 AAACACACTGCTCAGGGTATAGG - Intergenic
968785638 4:2620488-2620510 TAAGCTAGAGCTCAGGAGATGGG + Intronic
969215503 4:5719222-5719244 AAACCCGAAGGTCAGGAGTTGGG - Intronic
969637556 4:8378094-8378116 AAACCTTCAGCACAGGAGAGAGG + Intronic
969692117 4:8709463-8709485 GTGCCCACAGCCCAGGAGATGGG - Intergenic
970698761 4:18709967-18709989 AAGCCCAGAGCTGAGGAGACAGG - Intergenic
979378276 4:119975851-119975873 AAACTCCCAGCTCAAGTGATAGG - Intergenic
979460757 4:120980070-120980092 AACCCCAGAGCTCAGGATGTAGG - Intergenic
982368174 4:154603506-154603528 AAAGCCAAAGCTCAGGACTTCGG + Intergenic
982435703 4:155382213-155382235 CCACCCACACCTCAGGAGACAGG + Intergenic
982482377 4:155928037-155928059 AAACACACAGCTTAGGAGACTGG - Intronic
984819275 4:183866056-183866078 AAACCCACAGCATAGGTGAAGGG + Intronic
985155397 4:186982639-186982661 AAACCCACAGCACGGGTGATGGG - Intergenic
985338511 4:188922031-188922053 CCACCCACAGCTCAGTGGATGGG - Intergenic
985354278 4:189100704-189100726 AATCTCACAGCTGGGGAGATGGG - Intergenic
985766454 5:1782147-1782169 CCACACACAGCCCAGGAGATTGG - Intergenic
986333878 5:6738358-6738380 AAACCCACAGCTAAGGCACTGGG - Intronic
986750931 5:10787228-10787250 CACCCCACTGCTCAGGAGATAGG + Intergenic
986840299 5:11688701-11688723 AAACCCACCACCCAGGAGAAGGG + Intronic
988672939 5:33401521-33401543 AATTCCCCAGCTTAGGAGATGGG + Intergenic
994058239 5:95444573-95444595 TAACCAACAGCACAGGTGATTGG + Intronic
994060057 5:95465368-95465390 GAAACCACAGCTCAGGATCTAGG + Intronic
995816614 5:116176470-116176492 AAACCCACATCTCAGATGTTAGG - Intronic
999471401 5:151858175-151858197 ACACCCACAGCTCTGGATGTGGG + Intronic
1001582641 5:172809408-172809430 AAACCCACAGTCCAAAAGATGGG - Intergenic
1002412166 5:179089575-179089597 AAACCCTCAGCTAAGGAGAGAGG - Intergenic
1003507050 6:6748758-6748780 AAAAGCACAGCTCAGAAAATGGG + Intergenic
1004310929 6:14544198-14544220 AAACCCAAAGCCCAGGGGTTTGG - Intergenic
1005209490 6:23444140-23444162 AAACAGGCAGCTCAGGACATTGG - Intergenic
1007426229 6:41748005-41748027 AAACCCTCAGGGGAGGAGATAGG + Intronic
1008588272 6:52968745-52968767 AAAACCAGAGCTGAGGAGATGGG - Intergenic
1012913205 6:105139751-105139773 AAACACATAGCCCAGGATATGGG + Intergenic
1015680646 6:135804334-135804356 AAACCCACAGTTCAGGGCCTCGG - Intergenic
1016092481 6:139996702-139996724 AAAGCCACAGGTCATGAGGTGGG - Intergenic
1016176725 6:141085873-141085895 AAACTCATAGCTCATGACATTGG - Intergenic
1017154374 6:151309801-151309823 AATCCCAAAGCTCAGAAGAAAGG - Intronic
1017381287 6:153833994-153834016 AGACCCACATCTTAGGAGTTTGG + Intergenic
1017878964 6:158546601-158546623 TAACCCACAGTTCAGGGCATTGG - Intronic
1017966957 6:159275386-159275408 AAACACAGAGCTCAGGTGTTCGG - Intergenic
1017983517 6:159422785-159422807 ATGCCCACAGCTCAGGAGCTGGG - Intergenic
1024322579 7:48085755-48085777 AAAAGAACAACTCAGGAGATGGG - Intergenic
1026876305 7:73880952-73880974 AAACTAAAGGCTCAGGAGATTGG - Intergenic
1029362669 7:100098641-100098663 AAACCAACCGCTCAGGAGGGCGG - Exonic
1030257863 7:107530917-107530939 CAACACACAGATCAGGAGACAGG + Intronic
1034927286 7:155132412-155132434 AATCCCACAGCCCAAGAGAGGGG - Intergenic
1036237018 8:7047768-7047790 ACACCCAGAGCTCAGGAGAAGGG - Intergenic
1036280678 8:7397899-7397921 CACCGCTCAGCTCAGGAGATGGG - Intergenic
1037660028 8:20918440-20918462 GAATCCACAACTCAGGAGCTAGG + Intergenic
1038464184 8:27744953-27744975 GAACCCAAAGCTCAGGTAATTGG - Intronic
1038572533 8:28675186-28675208 AATCCCTCAGCTGAGGAGTTTGG - Intronic
1042807960 8:72792311-72792333 AAACACACAGCTTGGGAGGTGGG - Intronic
1043416267 8:80053768-80053790 AGACCCACAGGTCGGGAGAGTGG - Intronic
1046840283 8:118848850-118848872 AAACCTACATCTGATGAGATAGG + Intergenic
1048778423 8:137973838-137973860 AAACCCAAAGTGCATGAGATTGG + Intergenic
1049783384 8:144439119-144439141 GACGACACAGCTCAGGAGATGGG - Intronic
1050535048 9:6623778-6623800 AAACCCACATCTGAGAAGATAGG + Intronic
1051575395 9:18609587-18609609 AGTCCCACAGCTCTGGAGACAGG - Intronic
1051874373 9:21775902-21775924 AAACCTAGAGCTTAGGAGAAAGG + Intergenic
1052955414 9:34250053-34250075 AAACCCACAGGAAAGGAGGTTGG - Intronic
1056069626 9:82972751-82972773 AAACCCCAGGTTCAGGAGATAGG + Intergenic
1059402933 9:114081834-114081856 AAATCCACAGGTCTGGAGCTTGG + Intergenic
1060719210 9:125963660-125963682 AAACACACAGCTCTGGAAAAGGG + Intronic
1060919512 9:127409789-127409811 AAACCCAGAGCTTATGAGTTCGG + Intergenic
1187188884 X:17013977-17013999 AAATCCACAGCTCAAAAGGTTGG - Intronic
1187709408 X:22038886-22038908 AGACCCACAGACCAGAAGATAGG - Intronic
1189356337 X:40312723-40312745 TTTCCCACAGCTCTGGAGATTGG - Intergenic
1191793165 X:64992678-64992700 AAACCATCAGCACAGAAGATGGG - Intronic
1191904287 X:66072561-66072583 AAACCCACAACACAAAAGATGGG + Intergenic
1198587087 X:138134276-138134298 AAGTCCAGAGCTCAGGAGAAAGG - Intergenic
1200140744 X:153901792-153901814 ATACCTAGAGCCCAGGAGATAGG - Intronic