ID: 1158682982

View in Genome Browser
Species Human (GRCh38)
Location 18:59585279-59585301
Sequence CCCCCATGTAATCACCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158682972_1158682982 27 Left 1158682972 18:59585229-59585251 CCACCTCTACTCCCAAGGTACCC 0: 1
1: 0
2: 2
3: 12
4: 213
Right 1158682982 18:59585279-59585301 CCCCCATGTAATCACCTTCATGG 0: 1
1: 0
2: 0
3: 7
4: 79
1158682973_1158682982 24 Left 1158682973 18:59585232-59585254 CCTCTACTCCCAAGGTACCCAGG 0: 1
1: 0
2: 0
3: 23
4: 287
Right 1158682982 18:59585279-59585301 CCCCCATGTAATCACCTTCATGG 0: 1
1: 0
2: 0
3: 7
4: 79
1158682978_1158682982 6 Left 1158682978 18:59585250-59585272 CCAGGTCTCTCTGTTACAAGCCC 0: 1
1: 0
2: 0
3: 16
4: 155
Right 1158682982 18:59585279-59585301 CCCCCATGTAATCACCTTCATGG 0: 1
1: 0
2: 0
3: 7
4: 79
1158682975_1158682982 16 Left 1158682975 18:59585240-59585262 CCCAAGGTACCCAGGTCTCTCTG 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1158682982 18:59585279-59585301 CCCCCATGTAATCACCTTCATGG 0: 1
1: 0
2: 0
3: 7
4: 79
1158682977_1158682982 7 Left 1158682977 18:59585249-59585271 CCCAGGTCTCTCTGTTACAAGCC 0: 1
1: 0
2: 1
3: 15
4: 160
Right 1158682982 18:59585279-59585301 CCCCCATGTAATCACCTTCATGG 0: 1
1: 0
2: 0
3: 7
4: 79
1158682976_1158682982 15 Left 1158682976 18:59585241-59585263 CCAAGGTACCCAGGTCTCTCTGT 0: 1
1: 0
2: 2
3: 16
4: 207
Right 1158682982 18:59585279-59585301 CCCCCATGTAATCACCTTCATGG 0: 1
1: 0
2: 0
3: 7
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158682982 Original CRISPR CCCCCATGTAATCACCTTCA TGG Intronic
903464115 1:23540192-23540214 CCCGCATGGGATCACCTCCACGG - Intergenic
907310383 1:53535629-53535651 CCACCTTGTAATCACCTTCCAGG + Intronic
907760138 1:57349650-57349672 CTACCATGTAGGCACCTTCAAGG + Intronic
911707922 1:101036507-101036529 CCCCCATTTAATTATGTTCATGG - Intergenic
912686828 1:111774583-111774605 CCCCCATTTCAGCATCTTCAGGG + Intronic
917283839 1:173404336-173404358 CCCCCATGGAATTACCCACAGGG + Intergenic
920846320 1:209595826-209595848 CAGCCATGTAATCATCTTCAAGG - Intronic
1070833094 10:79432178-79432200 GCCCCATCTCATCACATTCACGG - Intronic
1071463586 10:85920610-85920632 CCTCCATGTGCTCCCCTTCAAGG + Intronic
1073490708 10:103851375-103851397 CCACCATGAACTCACCTGCAGGG + Intronic
1075954491 10:126510292-126510314 CCCCCATCTCATCCCCTTCTTGG - Intronic
1079996183 11:27297366-27297388 CCTTCATGAAATCACTTTCAGGG + Intergenic
1081570527 11:44287804-44287826 CCCCCTTGCAACAACCTTCAAGG + Intronic
1084880925 11:72171315-72171337 CCCCCAGGTGATCACCTTATTGG + Intergenic
1085879630 11:80451071-80451093 TCCTCATGGAATCACCTTCAGGG - Intergenic
1086308885 11:85513601-85513623 TCCCCATTTAATCACCAGCAAGG + Intronic
1086950394 11:92884908-92884930 CCCACATGTAGTCATCTCCAGGG - Intronic
1089440949 11:118516196-118516218 TCCCCATGTTATCTTCTTCATGG - Intronic
1090438420 11:126706164-126706186 CCACCATGTACTAACTTTCATGG - Intronic
1090463363 11:126911469-126911491 CAGCCATTAAATCACCTTCACGG + Intronic
1090628292 11:128624736-128624758 CCCCCATTTAATCACCAGAAGGG + Intergenic
1090881215 11:130832664-130832686 CCCAAATGTAATCTCCTCCAAGG + Intergenic
1095208174 12:39462224-39462246 CACCCTCTTAATCACCTTCAGGG - Intergenic
1099028344 12:77493722-77493744 CGCCCATGTAATCAGTTCCATGG - Intergenic
1099312447 12:81044445-81044467 CTACCCTGTAATCAGCTTCAAGG - Intronic
1101542642 12:105678843-105678865 GCCCCATCTAATCAGCTTCCAGG + Intergenic
1114440650 14:22744214-22744236 CCCCCACGTAATCACAATCCAGG - Intergenic
1114469601 14:22950587-22950609 CCCCCATGTTCTCACCAACATGG - Intronic
1125084170 15:35711364-35711386 CTTTTATGTAATCACCTTCATGG - Intergenic
1133881165 16:9783883-9783905 ACCCCATGTTCTCACTTTCAAGG + Intronic
1135767736 16:25192403-25192425 GCCTCATAGAATCACCTTCATGG - Intergenic
1135878985 16:26234484-26234506 CCCCCATGTAACCACTAACAGGG - Intergenic
1140042678 16:71419374-71419396 CACCCATGAACTCTCCTTCATGG + Intergenic
1140888110 16:79262046-79262068 CCCCCAGGCAGTCACATTCAGGG + Intergenic
1140897120 16:79334492-79334514 CACCCATGTAACCACCTCCTTGG - Intergenic
1142286173 16:89172375-89172397 CCCCCAGGAACTCACCCTCACGG + Intronic
1145958983 17:28874924-28874946 CACCCATGTAATCACCATCCAGG + Intergenic
1149617687 17:58015181-58015203 CCCCCAAGTAATCATTTCCAGGG - Intergenic
1150938996 17:69669772-69669794 CCCCTATGCAATGCCCTTCAGGG + Intergenic
1158682982 18:59585279-59585301 CCCCCATGTAATCACCTTCATGG + Intronic
1163138553 19:15331658-15331680 CCCCCATCTCTTCACCTTCCCGG - Intronic
1164820365 19:31245676-31245698 ACCCCATGTAATCCTCTGCAAGG - Intergenic
1167113858 19:47477339-47477361 TTCCCATGTAATCATGTTCATGG + Intronic
926758706 2:16257255-16257277 TCCCCAGGTAATCAGTTTCATGG - Intergenic
939923001 2:148139978-148140000 CCCCAATGTAATCATTTTCACGG - Intronic
942888048 2:180952643-180952665 ACAACATGTAAACACCTTCATGG - Intergenic
943110592 2:183600003-183600025 CACCCATGAAATAACATTCAAGG - Intergenic
945050090 2:205815524-205815546 CCACCATGGAAACACCTTCATGG - Intergenic
947321036 2:228919391-228919413 ACCCCTTGTCAGCACCTTCAGGG + Intronic
947327606 2:228994729-228994751 AACCCCTGTAATCACCTTCCTGG + Intronic
948035310 2:234853539-234853561 CCCCCATTCAAAGACCTTCAAGG + Intergenic
1172153301 20:32805887-32805909 CCCCCACGTGATCTCGTTCATGG + Intronic
1180882774 22:19218233-19218255 CCAACATGAAGTCACCTTCAAGG + Intronic
1181984473 22:26789953-26789975 CCCCCATGTAAGCATTTTCCAGG - Intergenic
1184855266 22:47143023-47143045 CCACCAGGCAGTCACCTTCAAGG - Intronic
1184970970 22:48019603-48019625 CCCCCATTTCATCATCTTCATGG - Intergenic
952907432 3:38151292-38151314 CCCCAAGATAATGACCTTCAAGG + Intergenic
957002700 3:74905030-74905052 CACCCATGTAATCAACATCCAGG + Intergenic
963075827 3:141345421-141345443 CCCCCATGTATACACCACCATGG - Intronic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
975707310 4:77123848-77123870 CCCACAGGTAATCTCCTTCTGGG - Intergenic
976171999 4:82313810-82313832 CCACCATGTAAGGACCTTGAAGG + Intergenic
985001785 4:185492237-185492259 ATTCCATCTAATCACCTTCAAGG + Intergenic
992001459 5:72440565-72440587 CCCACATGGACTCTCCTTCAAGG + Intergenic
995497525 5:112762746-112762768 CACCCATGTAATCACTATCTAGG - Intronic
1006781037 6:36632483-36632505 CCAGCGTGTAATCACGTTCAGGG - Intergenic
1008157903 6:48039521-48039543 CACCCATGTAAACACCACCAAGG - Intronic
1013198052 6:107863414-107863436 CCTCTAGGTAATCACATTCAAGG + Intergenic
1013386034 6:109632093-109632115 CCCCCATGTAACCACCAACCAGG - Intronic
1014854475 6:126382258-126382280 ATCCCATTTAATGACCTTCAAGG - Intergenic
1027688004 7:81302010-81302032 CGCCCATGTCACCACCTGCATGG - Intergenic
1031744681 7:125479364-125479386 CCCCCATGAAATCATCAGCATGG - Intergenic
1033766451 7:144497505-144497527 ACCCCAAGTAATCCCCTTGAAGG + Intronic
1035036791 7:155900870-155900892 CCCAGATGCAGTCACCTTCATGG + Intergenic
1041663807 8:60423484-60423506 AGCCCATGCCATCACCTTCACGG - Intergenic
1042056176 8:64766815-64766837 AGCCCATGCCATCACCTTCACGG + Intronic
1042130926 8:65586277-65586299 AGCCCATGAAATCACCCTCATGG + Intergenic
1047894759 8:129354215-129354237 CCCCCATGCCACCACCTTCCAGG + Intergenic
1049604143 8:143521284-143521306 CCCACATATCACCACCTTCACGG - Intronic
1049758355 8:144320734-144320756 GCTCCATCTAATCACCTTCCTGG + Intronic
1060273781 9:122166908-122166930 CCCCCAGCTGATCACCTTTATGG - Exonic
1061211047 9:129193684-129193706 CTCCCATCTCATCGCCTTCATGG + Intergenic
1192737258 X:73861429-73861451 CACCCATGTAAGCAACATCAGGG + Intergenic
1192872088 X:75194522-75194544 CACCCCTGAAAACACCTTCATGG - Intergenic
1198541687 X:137646585-137646607 CCCCCGTGTCATCGCCTTCTAGG + Intergenic
1200694307 Y:6344848-6344870 CTCCCATTTTATCACCTTAATGG - Intergenic
1201040970 Y:9829868-9829890 CTCCCATTTTATCACCTTAATGG + Intergenic