ID: 1158686135

View in Genome Browser
Species Human (GRCh38)
Location 18:59616306-59616328
Sequence GAGGCGGCCCTGAAAAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158686135 Original CRISPR GAGGCGGCCCTGAAAAATGA TGG Intronic
901129505 1:6953497-6953519 AAGGCGGCCCTGAGCAAGGAAGG - Intronic
905871340 1:41406306-41406328 GAGAGTGCCCAGAAAAATGATGG + Intergenic
906045286 1:42825452-42825474 GAGGAGGCTCCCAAAAATGAGGG - Intronic
906366528 1:45214792-45214814 GCAGTGGCCCTGAAAAATGGCGG - Intronic
915563516 1:156701229-156701251 GGTGCAGCCCTGAAAGATGAGGG + Intronic
915853514 1:159354035-159354057 GAGGCTTCTCTGAAAAGTGAGGG + Intergenic
917094194 1:171383302-171383324 GAGGGGGCACTGAAAAGAGAAGG - Intergenic
920245149 1:204582295-204582317 GAGGCAGCCCTGAAAAGAGGAGG - Intergenic
923124126 1:231020748-231020770 GAGGAAGCCCTGGAAGATGAAGG + Intronic
1064528347 10:16281782-16281804 GAGGCTGCAGTGAGAAATGATGG + Intergenic
1067830560 10:49609339-49609361 GAGGAGGCTCTGGAAAATGAGGG + Intronic
1069556783 10:69403423-69403445 GAGGCTGCACTGAATCATGATGG + Intergenic
1069583013 10:69577924-69577946 GAGGCGGCCCTGAGCAGGGAGGG - Intergenic
1070533916 10:77361377-77361399 GAGGAGGCCCTGAACAGTGCTGG + Intronic
1076066920 10:127456054-127456076 GAAACAGCCCTGGAAAATGAAGG - Intergenic
1079139811 11:17800887-17800909 GAGGCAGGCCTTAAAATTGAAGG + Intronic
1079372374 11:19862615-19862637 GAAGCGGACCTCAGAAATGAGGG - Intronic
1079386451 11:19984293-19984315 AGGGGGGCCCTGAGAAATGAGGG + Intronic
1079640642 11:22800618-22800640 CTGGTGGCCCTGAAAACTGAGGG - Intronic
1082248136 11:49948889-49948911 TATGCAGCCATGAAAAATGATGG + Intergenic
1082698172 11:56396536-56396558 GAGGTGGCCTTGAAGGATGACGG - Intergenic
1086167738 11:83798928-83798950 GGAGCTGCTCTGAAAAATGAAGG + Intronic
1086191060 11:84079771-84079793 GAGGTGGCCATGAGAAATCAGGG - Intronic
1087258661 11:95985591-95985613 GAGGTGGCCTTGACAAATGTCGG + Exonic
1089314928 11:117585092-117585114 GAGGAGGCCCTGAATAATCCTGG - Intronic
1089844629 11:121448895-121448917 GAGGCTGCTCTGAAACCTGAAGG + Intergenic
1090343227 11:126044298-126044320 GTGGCTGCCCTGCAAAATAATGG + Intronic
1090405958 11:126475887-126475909 GAGGCTGCCTTGAAGAAAGAAGG - Intronic
1090539448 11:127684605-127684627 GTGGCTGCGGTGAAAAATGAAGG + Intergenic
1091441902 12:517500-517522 GAGGTGGCCCTGTAAAATCTAGG + Intronic
1100086593 12:90918166-90918188 GAGGAAGCCCTGAGAAAAGAAGG - Intronic
1101215284 12:102575546-102575568 GATGCGGGCCTGGAACATGATGG + Intergenic
1102260351 12:111439641-111439663 GAGGCTGCCGTGAACTATGATGG - Intronic
1103962773 12:124619640-124619662 GACGCAGCCTTGAAAAAGGAAGG + Intergenic
1104336713 12:127903290-127903312 GAGGCTCCCCTGAAGAATGTGGG - Intergenic
1106236598 13:27866612-27866634 GAGGCCGCCATGAACTATGATGG - Intergenic
1112914382 13:104528655-104528677 GAGAAGGCTCTGAAAAATCAGGG - Intergenic
1113389781 13:109884559-109884581 GAGGGGGCCATGGAAAATAAAGG + Intergenic
1118769418 14:68931968-68931990 GAGGCAGCCCTTGAAAATGTTGG + Intronic
1202854662 14_GL000225v1_random:43065-43087 GACGCGGCCCTGAAGAAGGCAGG + Intergenic
1125883647 15:43213010-43213032 GAGGAAGCCCTGAAAAATCTGGG + Intronic
1127623236 15:60754587-60754609 GAGTTGTCCCTGAAGAATGAGGG - Intronic
1128988795 15:72241355-72241377 GAGGCTGCCCTGAGGAATCAAGG - Exonic
1130647354 15:85740908-85740930 GAGACGGGCTTGAAAAATGAGGG + Intronic
1133163058 16:3924877-3924899 GAGGCACCCATGAAAAGTGAGGG + Intergenic
1139386190 16:66572980-66573002 GAGGCGGCCTTGACAAAATATGG - Intronic
1140696919 16:77543874-77543896 AAGGAGGCACTGAACAATGAAGG + Intergenic
1141360703 16:83392868-83392890 GAGCCGCCCCTGAAGAATGTTGG + Intronic
1143471226 17:7177318-7177340 GAGGTGGCCCTGCAAGAGGAGGG + Exonic
1144956313 17:19020578-19020600 GCGGGAGCCCTGAAAAATTAGGG + Exonic
1145193894 17:20869753-20869775 GAGGCGGCTTTGTGAAATGAGGG + Intronic
1145298141 17:21611418-21611440 GAGGCGGCTTTGTGAAATGAGGG - Intergenic
1145352116 17:22091979-22092001 GAGGCGGCTTTGTGAAATGAGGG + Intergenic
1151532481 17:74715552-74715574 GGGGCTGCCCTGAAAAACAAGGG + Intronic
1153564969 18:6410150-6410172 GAGACGGCCCTGAGACAGGAGGG - Intronic
1155650404 18:28134086-28134108 GAGGCTGCCATGAACAATAATGG + Intronic
1157223942 18:45846190-45846212 CAGGGGGCCCAGAAACATGAGGG - Intergenic
1158254490 18:55530546-55530568 GAGGTGGCCCTGAAAAGGGGGGG + Intronic
1158686135 18:59616306-59616328 GAGGCGGCCCTGAAAAATGATGG + Intronic
1159729917 18:72013354-72013376 GAGAATGCCCTAAAAAATGAGGG - Intergenic
1160770487 19:828724-828746 GAGGGGGCCCAGAGAAAGGAAGG + Intronic
1164526134 19:29014936-29014958 GAGGCTGCCCTGAGCAAGGAGGG - Intergenic
1164540604 19:29119019-29119041 GAGGAGGCCCAGAGAAAGGATGG - Intergenic
1164658436 19:29941554-29941576 GAGGCTGCAGTGAGAAATGATGG + Intronic
1166312943 19:41973318-41973340 GAGGCTGCCATGAACCATGATGG - Intronic
925565785 2:5252905-5252927 AAGGTTTCCCTGAAAAATGATGG + Intergenic
933834328 2:86232973-86232995 GAGGAGGCCCTGGAAAATTCCGG - Intronic
933857409 2:86429193-86429215 GAGGCGGCCCCAAAGACTGAGGG + Intergenic
935331061 2:101978496-101978518 GAGGCAGCTCTGAACAAAGAAGG + Intergenic
935375458 2:102391424-102391446 TGTGCGGCCCTAAAAAATGATGG - Intronic
935831416 2:107004830-107004852 GAGGCAGCCCTGAATTATGCCGG + Intergenic
937059790 2:118972407-118972429 GAGGCAGCCTTGCAAAGTGATGG + Intronic
937724014 2:125138254-125138276 TAAGCGGCCCTGATAAATCAAGG - Intergenic
939974642 2:148703495-148703517 GAGTGAGGCCTGAAAAATGAGGG + Intronic
941667020 2:168252423-168252445 GAGTTGGCCATGACAAATGACGG - Intergenic
944499598 2:200345517-200345539 TAGACTGCCCTGCAAAATGAAGG + Intronic
944656950 2:201885006-201885028 GAGTGGGCCTTGAAAGATGATGG + Intronic
947987004 2:234456818-234456840 GTGGCAGCCCTGAAAAAAAAAGG + Intergenic
1170434926 20:16316544-16316566 AAGGAGTCTCTGAAAAATGAGGG + Intronic
1170934620 20:20798866-20798888 GAGGCTGCCCTGAGCTATGATGG + Intergenic
1171238885 20:23549291-23549313 GAGGTTACCCTGAAAACTGATGG - Intergenic
1172026569 20:31952767-31952789 GAGGCTGCCCTGAGCTATGATGG + Intergenic
1175307301 20:57985150-57985172 GAGTCAGGGCTGAAAAATGAGGG - Intergenic
1175750367 20:61492900-61492922 GAAGCAGCCATGAAAGATGAGGG + Intronic
1176305386 21:5120466-5120488 GAGGCTCCCCTGAAAACTGCAGG - Intronic
1179851669 21:44141565-44141587 GAGGCTCCCCTGAAAACTGCAGG + Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1182331591 22:29554963-29554985 CAGGTGGCCCTGCAGAATGAGGG + Exonic
1184401833 22:44278958-44278980 GAGCCTGCCCTGGACAATGATGG - Intronic
950127555 3:10519328-10519350 GAGGCGGGAGTGAATAATGAAGG + Intronic
950778121 3:15367891-15367913 CAGGCTGCCGTGAAAACTGAAGG + Intergenic
953469396 3:43154261-43154283 GAGGCAGCCCTGAAAACTGAAGG + Intergenic
954403894 3:50334407-50334429 GTGTGGGCCCTGGAAAATGAGGG + Intronic
957083976 3:75663475-75663497 GAGGCTGCCCTGGAATATGGTGG + Intergenic
963699140 3:148601863-148601885 GAGTTGGCCCTGAAAAATAGTGG - Intergenic
965719922 3:171650391-171650413 GAGGCAGGCCTGAAAGGTGAAGG + Intronic
965743439 3:171900616-171900638 GAGGAGGCCCTGAAACCAGATGG + Intronic
967553806 3:190831446-190831468 GAGGGGGCCCTGGAAGAGGAGGG - Intergenic
968649415 4:1754513-1754535 GAGGGGGACCTGAACACTGAAGG + Intergenic
971895021 4:32580962-32580984 GGGGTGGCCCTGAAAAATAGTGG - Intergenic
972657241 4:41076279-41076301 GAGGCAGCACTGAAAACTGGGGG + Intronic
976818715 4:89180399-89180421 GAGGCTGCAGTGAACAATGAGGG - Intergenic
990608785 5:57437092-57437114 GAGCCAGCCCTGAAAGATGATGG - Intergenic
990682583 5:58261929-58261951 GAGGAGCTCCTTAAAAATGATGG + Intergenic
994659473 5:102636378-102636400 GAGGCAGCACTGGAAAAAGAAGG + Intergenic
994997695 5:107085485-107085507 AAGGCGTGCCTGAGAAATGAGGG + Intergenic
998856715 5:146401106-146401128 GAGGCAGTGCTGTAAAATGACGG + Intergenic
1012437139 6:99226567-99226589 GAGGAGGCCCTGCACAGTGAAGG + Intergenic
1012548632 6:100448348-100448370 GAATCGGCCCTGGAAAGTGAGGG - Intronic
1014152927 6:118079639-118079661 GAGGCTGCCCTCAAATATGCTGG + Intronic
1015803992 6:137090222-137090244 GAGGGGGCGATGAAATATGAGGG + Intergenic
1017591083 6:155978651-155978673 GAGGCGGCCCTGGAAATTTGTGG - Intergenic
1018653334 6:166009085-166009107 GAGACAGCCGAGAAAAATGACGG - Intergenic
1019353993 7:569589-569611 GAGGCTGCCCTGCAACAAGAGGG + Intronic
1023274818 7:38506967-38506989 GAGCCGGCCATGAAAAGGGATGG + Intronic
1024046168 7:45587161-45587183 GAGGCTGCTCTGTAAAAGGAGGG + Intronic
1034341952 7:150363092-150363114 GGGGAGGCCCCGAAAGATGAAGG - Intergenic
1041731394 8:61066667-61066689 GAGGTTGCCCTGAAAAACAAGGG + Intronic
1043401963 8:79892452-79892474 AAGGAATCCCTGAAAAATGATGG + Intergenic
1048519758 8:135142520-135142542 GAGGTGGCCTTGAAAAAGAAGGG - Intergenic
1051816081 9:21106717-21106739 GAGTCTGCCCTGGAAATTGAGGG + Intergenic
1053311938 9:37025976-37025998 GAGGGGGCTTTGAAAAATCAAGG - Intronic
1055470780 9:76608132-76608154 GAGGGGGCACAGAGAAATGATGG + Intergenic
1057267797 9:93630496-93630518 GAGGCGGGGCTGGAAAAGGAGGG - Intronic
1060009710 9:120032816-120032838 GTGGCTGCTCTGAAAAATGCAGG + Intergenic
1061231860 9:129320077-129320099 GGGCCGGCCCTGAAGAGTGATGG - Intergenic
1187429287 X:19206927-19206949 GAGGCTGCATTGAAACATGATGG - Intergenic
1193348321 X:80429667-80429689 GAGGAGGCCCAGGAAAAAGAGGG - Intronic
1198546317 X:137696242-137696264 GAGGCTGAGCTGAAAAATCAGGG + Intergenic
1201726696 Y:17159793-17159815 GAGGCTGCCATGAGCAATGATGG + Intergenic