ID: 1158690175

View in Genome Browser
Species Human (GRCh38)
Location 18:59653178-59653200
Sequence ATGTCCTTCTTGGAGAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158690175_1158690186 27 Left 1158690175 18:59653178-59653200 CCAGCCCTCTCCAAGAAGGACAT 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1158690186 18:59653228-59653250 GGCAAATATTCCCCTACCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 103
1158690175_1158690187 28 Left 1158690175 18:59653178-59653200 CCAGCCCTCTCCAAGAAGGACAT 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1158690187 18:59653229-59653251 GCAAATATTCCCCTACCCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 114
1158690175_1158690185 26 Left 1158690175 18:59653178-59653200 CCAGCCCTCTCCAAGAAGGACAT 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1158690185 18:59653227-59653249 TGGCAAATATTCCCCTACCCAGG 0: 1
1: 0
2: 0
3: 6
4: 93
1158690175_1158690180 6 Left 1158690175 18:59653178-59653200 CCAGCCCTCTCCAAGAAGGACAT 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1158690180 18:59653207-59653229 TGCCTCCTATCCCAGAGAGCTGG 0: 1
1: 0
2: 1
3: 25
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158690175 Original CRISPR ATGTCCTTCTTGGAGAGGGC TGG (reversed) Intronic
900827838 1:4940862-4940884 ATTTCTTTCTTGGGGAGGACTGG + Intergenic
901225136 1:7608930-7608952 ATGTCCTTCTAGAAAAGGCCAGG - Intronic
902174552 1:14639311-14639333 GTTTCCCGCTTGGAGAGGGCTGG - Intronic
902818853 1:18931315-18931337 ATTTCCTCCTTGGAGTGGCCTGG - Intronic
903747570 1:25598503-25598525 CTGTCCTTCCTGGAGCCGGCAGG + Intergenic
904889219 1:33765901-33765923 ATGTCCCTCCTAGACAGGGCTGG + Intronic
907243184 1:53091874-53091896 ATGTCGTTGGTGGAGGGGGCAGG - Intronic
909561899 1:77016529-77016551 ATGGCCTTCTTTCAGGGGGCAGG - Intronic
913515655 1:119603457-119603479 ATGGCCTTCTTGGAGTTGCCTGG + Intergenic
914931217 1:151935435-151935457 ATCTTCATCATGGAGAGGGCTGG + Intergenic
915031276 1:152882265-152882287 AAGTCTTTCTGGGGGAGGGCCGG - Intronic
915113523 1:153580376-153580398 ATGGCCTTCTTGGACAGGCACGG - Intergenic
916448121 1:164892782-164892804 ATGCACTTCATGGAGGGGGCTGG + Intronic
917727162 1:177839023-177839045 ATGTCCATGGTGGAGAGGGAGGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918970770 1:191415422-191415444 AAGTCCTTCTTGGCTAGTGCTGG + Intergenic
919739796 1:200974654-200974676 ATCTCCTTCCTGGTGTGGGCAGG - Intronic
920110388 1:203583218-203583240 AAACCCTTCTTGGAGATGGCAGG + Intergenic
920565379 1:206968872-206968894 AAGGCCTTAGTGGAGAGGGCTGG - Intronic
923387362 1:233478494-233478516 ATGTCTTTCTTCAAGATGGCAGG + Intergenic
1062777811 10:169003-169025 TTGTGCTTCTTGGAGCGGGAGGG + Intronic
1063245357 10:4212367-4212389 ATGACATTCCTAGAGAGGGCTGG - Intergenic
1063622872 10:7665693-7665715 ATGTCCTCGTTGGTCAGGGCAGG - Intronic
1067800452 10:49354810-49354832 CTGTCTGTCTTGGAGTGGGCAGG + Intergenic
1067838629 10:49657720-49657742 ATCTCCTGCTTGGTGAGGGATGG - Intronic
1067919473 10:50438702-50438724 ATGTCCTTCTGAGAGAGGAGAGG + Intronic
1068673928 10:59750691-59750713 CTGTGATTCATGGAGAGGGCTGG - Intergenic
1071021402 10:81061208-81061230 TGGTCCTTCTTGGGGAGGGAAGG + Intergenic
1075390813 10:122090098-122090120 AGCACCTTCTTGGAGAAGGCAGG + Intronic
1076130205 10:128008739-128008761 ATGTGCTTCTGAGAAAGGGCTGG - Intronic
1077285251 11:1762728-1762750 CTGTCCTCCTTGGAGAGGGGAGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080901010 11:36490938-36490960 ATGTTAATCTTGGAGAGGACAGG - Intronic
1081513650 11:43802669-43802691 TTGTCCTTCTTGGCTAGGGGAGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082991760 11:59212713-59212735 AAGTCCTACCTGGAGGGGGCTGG - Exonic
1084568044 11:69942733-69942755 TTGTCCTTGCTGGGGAGGGCAGG - Intergenic
1085171635 11:74454493-74454515 AGCTCCCTCCTGGAGAGGGCAGG - Intergenic
1085525054 11:77159323-77159345 ATGCCCTCCCTGGACAGGGCAGG + Intronic
1086400675 11:86458908-86458930 ATGACCTTGTTGGAGAGGGAAGG - Intronic
1087160715 11:94945549-94945571 TTGTGCTGCCTGGAGAGGGCAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088813053 11:113404493-113404515 ATGTCCTCCTTGAGGTGGGCTGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091124091 11:133081164-133081186 ATGTCCCTGGTGGAGAGGGGAGG + Intronic
1092109356 12:5948033-5948055 ATTTCCTTTGTGGTGAGGGCTGG - Intergenic
1092957364 12:13562901-13562923 ATGTCCTTCTGGAAACGGGCTGG + Exonic
1094796525 12:33979610-33979632 ATGTCCTTCGAGGAAAGAGCAGG + Intergenic
1095109084 12:38271601-38271623 ATGTCCTTCGAGGAAAGAGCAGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1107928016 13:45282238-45282260 ATTTCCTTCTTGGAGAAGAAAGG - Intronic
1112307705 13:98290145-98290167 ATTTCCCCCTTGTAGAGGGCTGG + Intronic
1114364466 14:22012197-22012219 CTGTCATTCCTGGAGAGGACAGG - Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116764008 14:49048920-49048942 AGGTCCTTCATGGAGTGAGCTGG - Intergenic
1118175888 14:63439767-63439789 ATGTCCATCATGGAGATGGAGGG + Intronic
1118729743 14:68658071-68658093 ATGCGCTTCTTGGCAAGGGCAGG - Intronic
1118814698 14:69301814-69301836 TTGTACTTTTTGGAGAGAGCAGG - Intronic
1119981498 14:79086822-79086844 ATGTTCTTCATGGAGATGACAGG + Intronic
1120312069 14:82841651-82841673 AGGGCCTTCTTGCTGAGGGCAGG - Intergenic
1121462560 14:94093097-94093119 ATGCCCTTCTTGGAGATGTGAGG + Intronic
1122051613 14:99064814-99064836 ATGTCCTTCCGGGAAAGGCCCGG - Intergenic
1128314924 15:66654439-66654461 GTGTGATTCTTGGAGGGGGCAGG + Intronic
1129650249 15:77481262-77481284 CTGTACTTCTTAGAGATGGCTGG + Intronic
1131362182 15:91803057-91803079 ATGGCCTTCCTGCAGAGGGACGG + Intergenic
1132598116 16:762392-762414 CTGCCCTTCTGGGAGAGGGGTGG + Intronic
1132884694 16:2177494-2177516 CAGTACTTCTTGGAGGGGGCAGG + Exonic
1133239317 16:4405055-4405077 ATGTCCCTCTTGCAGAGCCCAGG + Intronic
1133741969 16:8658696-8658718 ATCTCCGTCTTTGGGAGGGCGGG + Intergenic
1134511750 16:14854176-14854198 ATGTCCTTATCGTAGAGAGCTGG + Intronic
1134699393 16:16252672-16252694 ATGTCCTTATCGTAGAGAGCTGG + Intronic
1134972436 16:18542000-18542022 ATGTCCTTATCGTAGAGAGCTGG - Intronic
1135291877 16:21246800-21246822 ATCTCCCTCTTAGAGAAGGCAGG - Intronic
1136346360 16:29678858-29678880 ATGTGCTCCCTGGTGAGGGCAGG - Intronic
1137763335 16:50958418-50958440 GTGTCCTCCTTGGTGTGGGCTGG + Intergenic
1138454442 16:57113324-57113346 ACGAACTTCTTGGAGAAGGCGGG - Exonic
1139365274 16:66428798-66428820 AAGGCCTCCTTGGAGGGGGCTGG - Intronic
1139442868 16:66977533-66977555 ATGCCCTTGGCGGAGAGGGCTGG - Intergenic
1140124383 16:72107692-72107714 ATGAGCATCTTGGACAGGGCAGG - Exonic
1140543968 16:75788595-75788617 ATGTCCTACATGGTGAGAGCAGG - Intergenic
1140866473 16:79066732-79066754 AAGTCCTTCTGGTAGAAGGCAGG - Intronic
1141887571 16:86903119-86903141 ATCTTCATCTTGGAGAGGGGAGG + Intergenic
1143032396 17:3975012-3975034 ATGACCTTCGTGCAGTGGGCTGG - Intergenic
1144849710 17:18237898-18237920 ATGTCCTTCTTGGAGCTGCCAGG - Intronic
1145053248 17:19680666-19680688 ATGTCCTTTTTAAACAGGGCAGG - Intronic
1146471942 17:33131709-33131731 ATGGTCCTCTTGGAGAGGACAGG - Intronic
1149940849 17:60864130-60864152 ATGTTTTTCTTGGAAAGGGATGG + Intronic
1152179900 17:78812897-78812919 ATGTTCTTCTTGGAGTGATCTGG + Exonic
1152295841 17:79466473-79466495 CTGTGCTCCTTGGGGAGGGCAGG - Intronic
1154102527 18:11489397-11489419 GTCTCCTTGTTGGAGGGGGCGGG + Intergenic
1154382510 18:13865432-13865454 ATTTGGTTCTTGGAGAAGGCTGG + Intergenic
1155922686 18:31619036-31619058 ATATCCGTCTTGGAGAGGCAAGG + Intergenic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1158690175 18:59653178-59653200 ATGTCCTTCTTGGAGAGGGCTGG - Intronic
1159609075 18:70506845-70506867 ATGTCTTTCTGGGAGAGAGGAGG + Intergenic
1160890221 19:1373825-1373847 ATGTCCTCCCTGGGCAGGGCAGG + Intronic
1161799785 19:6411133-6411155 ATTTACTTTTTGGAGAGGACAGG - Intergenic
1164636107 19:29792581-29792603 ATGTCCTTGATGGTGAGGACAGG + Intergenic
1166459232 19:42971579-42971601 ACATCCTTCTTGGAAAGGGAGGG - Intronic
1166476178 19:43126848-43126870 GCATCCTTCTTGGAAAGGGCGGG - Intronic
1166976314 19:46607139-46607161 TTGTTGTTCTTGGGGAGGGCAGG - Intronic
1168252618 19:55149100-55149122 ATGTCCTTGGGGGAGGGGGCAGG - Intronic
1168494091 19:56836064-56836086 CCGTCCTTCTTGGAGACGACTGG - Exonic
926220776 2:10934310-10934332 ATGCTCTGCTTGGAGAGGGCAGG + Intergenic
932460055 2:71876225-71876247 ATGTCAATCTTGGGGAGGGAAGG + Intergenic
937075677 2:119104600-119104622 CTGTCCTTCCTCCAGAGGGCAGG + Intergenic
937188051 2:120064911-120064933 ATGTTCTTCTGGGAAAGGTCTGG - Intronic
939522331 2:143246651-143246673 ATATCCTTGGAGGAGAGGGCAGG + Intronic
942649357 2:178150365-178150387 CTGTCCTTGCTGGTGAGGGCAGG + Intergenic
948768757 2:240236629-240236651 AAGGCCTGCTTGGAGGGGGCTGG + Intergenic
1169698297 20:8416687-8416709 ATGACCTGCTTGGAGATGGAAGG + Intronic
1170095277 20:12639207-12639229 AGGTCCTTCTGGGAAAGGGCTGG - Intergenic
1170732735 20:18988590-18988612 ATGTTCTTGTGGGAGAGAGCGGG - Intergenic
1171961302 20:31496948-31496970 ATGTCCTGCCGGGAGAGGCCAGG + Intergenic
1172404365 20:34676813-34676835 GTGGGGTTCTTGGAGAGGGCGGG - Intronic
1172831184 20:37836385-37836407 ATGTCCATGTGGGAGAGGGGAGG - Intronic
1173849245 20:46207468-46207490 GTGCCCTTCCTGGAGAGGTCTGG + Intronic
1173861386 20:46286051-46286073 TTCTCCTTCCTGGAGAGGGCTGG + Intronic
1179226072 21:39454594-39454616 CTGTGCATCTTGGAGACGGCAGG - Intronic
1183466574 22:37983231-37983253 CAGTCCTCCTTGGATAGGGCTGG - Intronic
1184075936 22:42177987-42178009 CTGTCCTTCCTGGAGTGGGGTGG - Intronic
1184796436 22:46736069-46736091 TGGTCCCTCTTGGAGAGGGAGGG - Intronic
1184956226 22:47888350-47888372 ATATGCTACTTGGAGAGAGCTGG + Intergenic
1185325246 22:50222350-50222372 ATGCTCTTCTAGGAGAGGGCTGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
954458822 3:50614477-50614499 CTGTCCTTACTGGAGAGGGGAGG - Intronic
956104829 3:65806849-65806871 ATGTCCCCCTTGAAGAGGGGAGG + Intronic
957529804 3:81426701-81426723 ATGTCATGTTTGGAGATGGCTGG - Intergenic
958271957 3:91511548-91511570 AGGTCCTTCTGGAAGAGGCCTGG - Intergenic
959861736 3:111224079-111224101 ACTTTCTTCTTGGAGAGGCCTGG + Intronic
961490383 3:127253255-127253277 ATGTCCTTTGGGGAGAGGGCAGG - Intergenic
962441118 3:135417036-135417058 AAGTCCTTCTCAGAGAGGGAAGG - Intergenic
963253532 3:143121912-143121934 ATGCCCTTCTTGGAGGCCGCGGG + Exonic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
964783592 3:160368674-160368696 ATGTAGTTCTTGGTGAGGACTGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967449468 3:189606849-189606871 ATCTCCTTCATTGGGAGGGCTGG + Intergenic
967733528 3:192928942-192928964 ATGCCCTTCCTTTAGAGGGCAGG - Intergenic
974854113 4:67438899-67438921 CTGTGCTTCTTGCAGAGGGAGGG + Intergenic
976241851 4:82966383-82966405 ATGTCCTTTTTAGAGTGTGCAGG - Intronic
980500258 4:133641773-133641795 ATATCATTTTTGAAGAGGGCAGG + Intergenic
980885273 4:138755842-138755864 ATTTCCTACTTAGAGAAGGCTGG + Intergenic
981117849 4:141012852-141012874 ATATGCTTCCTGGAGAGAGCAGG + Intronic
983599585 4:169511230-169511252 AGGGCCTTCTTGAAGAGGGGAGG - Intronic
986582521 5:9279995-9280017 ACCTCTTTCTTGGAAAGGGCTGG - Intronic
986783028 5:11084583-11084605 TTGACCTTCTGGGAGATGGCAGG + Intronic
987143689 5:14970511-14970533 ATGTCCTTGTTAGAGTGGGACGG + Intergenic
987682177 5:21151221-21151243 ATGTCCTTCTTTATGAGGGATGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993402223 5:87467646-87467668 TTTTGCTTCCTGGAGAGGGCGGG + Intergenic
1002107390 5:176886931-176886953 ATACCCTTCATGGAGTGGGCAGG - Intronic
1002455310 5:179342880-179342902 CTCTGCTTCCTGGAGAGGGCAGG - Intronic
1005605015 6:27467880-27467902 ATGTCCCCCTTGGAGAAGGGTGG + Exonic
1005854826 6:29852848-29852870 ATGTCCTTCCAGGACTGGGCTGG + Intergenic
1008566983 6:52778150-52778172 AGGTCCTTCTGTGAGTGGGCAGG - Intergenic
1008573382 6:52836164-52836186 AAGTCCTTCTTTGAGTGGGTGGG - Intronic
1008577882 6:52878694-52878716 AGGTCCTTCCTTGAGTGGGCGGG - Intronic
1008983154 6:57509589-57509611 AGGTCCTTCTGGAAGAGGCCTGG + Intronic
1009171211 6:60402455-60402477 AAGTCCTTCTGGAAGAGGCCTGG + Intergenic
1011012028 6:82713545-82713567 ATGTCCTTCTGAGATGGGGCAGG - Intergenic
1015022462 6:128492903-128492925 TTGTGCTTTTTGGAAAGGGCAGG + Intronic
1018983501 6:168617870-168617892 ATGGCCTACTTGGAGAGGCGGGG + Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1019701091 7:2475389-2475411 CTGTCCTTCCTGGAGACGGCCGG - Intronic
1019824084 7:3269040-3269062 ATATCCTTCTTGGTGATGTCTGG + Intergenic
1019960469 7:4455247-4455269 GTGTACTGATTGGAGAGGGCAGG - Intergenic
1020091637 7:5345360-5345382 ATCCCCTCCTTGGAGATGGCAGG + Intronic
1021814867 7:24437277-24437299 ATGCTCTTCTTGGTGAGGGTAGG + Intergenic
1023824193 7:43997752-43997774 ATTGCCTTTTGGGAGAGGGCAGG - Intergenic
1025234823 7:57227479-57227501 ATCTCCTGCTTGGGGTGGGCTGG + Intergenic
1027327905 7:77062681-77062703 ATTGCCTTTTGGGAGAGGGCAGG + Intergenic
1029219368 7:98975843-98975865 TTGTCCTTCTTGGATATGGTGGG + Intronic
1029612822 7:101636470-101636492 CTGTCCCACTTGCAGAGGGCAGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1036387795 8:8296927-8296949 GTGTCCTTCTGGGAGGTGGCAGG - Intergenic
1036481932 8:9147742-9147764 AAGTCCGGCTTGGAGAGGCCAGG + Intronic
1038337741 8:26659163-26659185 ATATCCTGTTTGGACAGGGCTGG - Intergenic
1042655881 8:71095976-71095998 CTGACCTTGTTGGGGAGGGCAGG + Intergenic
1044488809 8:92787866-92787888 ATGTACTTGTTGGAGGTGGCAGG - Intergenic
1044643547 8:94413325-94413347 ATGTCTTTTTTGGAGAGGAAGGG - Intronic
1047900882 8:129421240-129421262 ATTTCCTTTGTGGAGAGGGCAGG + Intergenic
1048095703 8:131290853-131290875 ATGGGCTTCTTGGTGAGGGGAGG - Intergenic
1049031035 8:140037998-140038020 ATGTCCTAGTTGGAGAGAGTGGG - Intronic
1050491789 9:6196026-6196048 ATGAACTTCTTAGAGAGTGCAGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057383593 9:94589461-94589483 ATGACCTGCTTGCAGAGGGCAGG + Intronic
1057582943 9:96303584-96303606 ATGTCCTTCTGGGGGTGGGATGG + Intergenic
1057889904 9:98862031-98862053 CTGTCCTGCTTGGAGAGTGCAGG + Intergenic
1060263760 9:122097353-122097375 ATCTGCTTCTTCAAGAGGGCAGG + Intergenic
1061785908 9:133028377-133028399 AGGTCCCCCCTGGAGAGGGCAGG + Intergenic
1061904830 9:133691268-133691290 ATGCCCTCCTGGGAGAGGCCTGG - Intronic
1185750829 X:2608927-2608949 CTGCCCTTCTTGGAGAGGTGTGG - Intergenic
1186511167 X:10130746-10130768 TTGTGCTTCTGGGTGAGGGCAGG - Intronic
1191882841 X:65859792-65859814 AGGTCCTTTCTGGAAAGGGCGGG - Intergenic
1191899532 X:66026504-66026526 ATGTTCTTCTCGGAGAGGAACGG + Intronic
1194583418 X:95704638-95704660 GTGTCCTTCTTTGTGAGGGGGGG - Intergenic
1196835975 X:119814199-119814221 GTTTCCTTCCTGGAGAGGGTAGG + Intergenic
1196836918 X:119821957-119821979 GTTTCCTTCCTGGAGAGGGTAGG + Intergenic
1197603540 X:128558880-128558902 ATGGCCTCTTTGGAGAGGGTGGG - Intergenic
1197951999 X:131908016-131908038 CTGTGCTATTTGGAGAGGGCTGG + Intergenic
1199109691 X:143916170-143916192 TTATCCTTCTTCTAGAGGGCTGG + Intergenic
1199984197 X:152938595-152938617 GTGTCCTTGTTGGGGAGTGCTGG + Intronic