ID: 1158692339

View in Genome Browser
Species Human (GRCh38)
Location 18:59671783-59671805
Sequence CAGATTAGATAAAAGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158692339 Original CRISPR CAGATTAGATAAAAGGATGG TGG Intronic
901754951 1:11435711-11435733 CAAATTATATAAAAGGAGAGGGG - Intergenic
904131981 1:28282001-28282023 CAGATGAGATACTGGGATGGGGG - Exonic
905193954 1:36259477-36259499 CAAATAAGGTAAAAGCATGGTGG + Exonic
906333574 1:44908600-44908622 AAGATGAGATATAAGGCTGGAGG + Intronic
906587006 1:46987160-46987182 CAAAATAAATAAAGGGATGGAGG + Intergenic
906810657 1:48823940-48823962 TACATAAGAGAAAAGGATGGTGG + Intronic
908615125 1:65911810-65911832 CAAAGTAGATAAGAGAATGGGGG - Intronic
910535307 1:88290836-88290858 CAGATGAGATTCAAAGATGGTGG + Intergenic
910797223 1:91109725-91109747 AAAAGGAGATAAAAGGATGGAGG - Intergenic
910826668 1:91416522-91416544 AAGATTAGAAAAATGGATGTTGG - Intergenic
911301860 1:96184267-96184289 GAGCTTAGAAAAAAGCATGGAGG - Intergenic
915850482 1:159316543-159316565 GAGGTAAGATAAAAGGAAGGTGG - Intergenic
916478910 1:165197550-165197572 CAGTGTAGGTAAAAGTATGGAGG - Intergenic
916997163 1:170313378-170313400 CAAAGTAAATAAAAGGATAGAGG - Intergenic
917157734 1:172022713-172022735 CAGATTACATAGAAATATGGAGG - Intronic
917560361 1:176146233-176146255 CAGATTAAACAAAAGGGTGTTGG - Intronic
918719758 1:187838282-187838304 CAGAATAGACAAGAGGATGGAGG + Intergenic
918853965 1:189726908-189726930 CAGATTAGATAAAGATATTGTGG - Intergenic
919829833 1:201532513-201532535 AAGATTTGATAAGATGATGGAGG - Intergenic
919842587 1:201619950-201619972 CAAATTAGAGAAAAGGATGAGGG + Intergenic
920286739 1:204885108-204885130 CATATTAAAAAAAAAGATGGGGG - Intronic
922924658 1:229338252-229338274 AAGATTAAATAAAAAGAGGGTGG + Intronic
1063803879 10:9615148-9615170 AAGACTAGATAATAGGATGTTGG + Intergenic
1065451950 10:25868592-25868614 CACATTAGATAATAGAATAGGGG - Intergenic
1066549386 10:36538676-36538698 CAGATTAGCTGAAAGAATGTTGG + Intergenic
1070341816 10:75504904-75504926 CAGAGTGGATAAATGGATTGGGG + Intronic
1070449025 10:76539143-76539165 CAGATGAGAAAAAAGGACAGTGG + Intronic
1071275404 10:84049627-84049649 TAGATTAGATTAAAAGATGAGGG + Intergenic
1072412736 10:95218771-95218793 CAGATTAGATGAAGGGAAGGAGG + Intronic
1073585174 10:104703175-104703197 CAGTTTAGATAAAATGATTCGGG + Intronic
1076946526 10:133655559-133655581 CAGTTGAGGTAAGAGGATGGGGG - Intergenic
1077998486 11:7474337-7474359 CACATTGGATAAATTGATGGAGG - Intergenic
1078207913 11:9246309-9246331 GACCTTAGATAAAAGGATGTAGG + Intronic
1078731165 11:13975274-13975296 CAGTAAAGATAAAAGGATGAGGG + Intronic
1079147136 11:17862873-17862895 TAGATAAGACAAAAGGATGGGGG + Intronic
1080107278 11:28524297-28524319 CAGATTAGATTAAAGGTATGTGG + Intergenic
1080224481 11:29945066-29945088 CAGATTAGGTAAGGAGATGGGGG + Intergenic
1080618097 11:33962339-33962361 TGGCTTAGATACAAGGATGGGGG + Intergenic
1085111149 11:73890109-73890131 CAGAAGAGATAAAAGGTTAGGGG + Intronic
1086750213 11:90484250-90484272 TTGTTTAGATAAAAGGATAGAGG + Intergenic
1087425208 11:97976536-97976558 CAGAGGAGATCAAAGGAAGGAGG + Intergenic
1088279827 11:108124576-108124598 AAGATTAGAAAAAGGGAAGGGGG - Intronic
1088330229 11:108643567-108643589 CACATTAGTTAAAAGGATGAAGG + Intergenic
1089514540 11:119024115-119024137 CAGATTAAATAACTTGATGGAGG - Exonic
1090186367 11:124741643-124741665 TAGAGAAGATAAATGGATGGTGG + Intronic
1090477338 11:127035612-127035634 CAGTTTGGATAAAAGGATTCTGG + Intergenic
1090537520 11:127660335-127660357 AAGATTAGAAAAAAGGTTTGAGG - Intergenic
1090538711 11:127676497-127676519 CAGATCAGATAAAATCATGGAGG + Intergenic
1090982343 11:131734443-131734465 CATGTTTGTTAAAAGGATGGGGG - Intronic
1092978774 12:13772371-13772393 CAGATGAGACAAAAAGCTGGTGG - Intronic
1093384469 12:18534626-18534648 AAGACTATATAAAAGGAAGGTGG + Intronic
1093923117 12:24881805-24881827 CAGATTACATGAAAGGATATGGG - Intronic
1094008571 12:25782367-25782389 CAGACTAGATAGATGAATGGAGG - Intergenic
1094228365 12:28073339-28073361 CAGAATAGAGAATAGAATGGTGG + Intergenic
1094619141 12:32063456-32063478 TACAATAGATAAACGGATGGTGG - Intergenic
1095170458 12:39029102-39029124 CTGATTAGATAAAATCATGTAGG + Intergenic
1095510686 12:42948788-42948810 CAGATTAGATAAAAGGCTTAGGG - Intergenic
1096427081 12:51513065-51513087 GAGATTAGATAAAATGATGGTGG + Exonic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1098254256 12:68600312-68600334 CAGATTAGAAAACAGGTTGCTGG - Intergenic
1099988504 12:89697760-89697782 CAGAGTAGAAAATGGGATGGGGG - Intronic
1100482503 12:94992855-94992877 CAGACAAGATAAAACGAGGGTGG - Intronic
1102188466 12:110967625-110967647 AAGATTAAATAAAAGGATGATGG + Intergenic
1102392742 12:112562756-112562778 AAGATTAGAGAAGAGGATGCTGG - Intergenic
1103372173 12:120427790-120427812 AAGATTTCATAAAAGGCTGGGGG - Intergenic
1104495865 12:129238071-129238093 CAGATTTGATATGGGGATGGTGG - Intronic
1105963589 13:25365333-25365355 TAGAATAGATAAAACGCTGGTGG - Intergenic
1106618368 13:31351329-31351351 CAGAATAGCTAAAAGCATGAAGG - Intergenic
1106675520 13:31954093-31954115 CAGATTATAAAAAAAGATGGAGG - Intergenic
1106842168 13:33695622-33695644 CAGATTATCTAACTGGATGGGGG - Intergenic
1107616083 13:42169877-42169899 CAGATTATTTTAAAGGATGGAGG - Intronic
1107956390 13:45516759-45516781 CATTTTACATAAAAGGAAGGTGG - Intronic
1108446298 13:50512147-50512169 CAGCTGAGAAAAGAGGATGGGGG + Intronic
1109852994 13:68091636-68091658 AAGAATGGATAAAAGGATTGGGG + Intergenic
1109968969 13:69739528-69739550 CAGACAAAATAAAAGGATGGAGG + Intronic
1110805968 13:79754768-79754790 GAGATATAATAAAAGGATGGTGG - Intergenic
1111126538 13:83916431-83916453 CACATATTATAAAAGGATGGAGG + Intergenic
1113108816 13:106799866-106799888 CAGATAAGAGAAAAGGAGAGTGG + Intergenic
1115735337 14:36321570-36321592 CAGCTTAGAGATAAGGAAGGTGG + Intergenic
1116355193 14:43919473-43919495 CAGATTGGATAAAGAGATTGTGG - Intergenic
1116933725 14:50716009-50716031 CAGATTTGATGAAATGATGGGGG + Intergenic
1122169813 14:99863103-99863125 ACAATTACATAAAAGGATGGAGG - Intronic
1122801372 14:104231322-104231344 CAGATGAGATGAAGGCATGGAGG + Intergenic
1202920631 14_KI270723v1_random:28181-28203 CAGTTGAGGTAAGAGGATGGGGG - Intergenic
1202924298 14_KI270724v1_random:9467-9489 CAGTTGAGGTAAGAGGATGGGGG + Intergenic
1123667633 15:22620750-22620772 GAGATAAGATAGAGGGATGGAGG + Intergenic
1124321477 15:28715317-28715339 GAGATAAGATAGAGGGATGGAGG + Intronic
1124481027 15:30080030-30080052 GAGATAAGATAGAGGGATGGAGG - Intergenic
1124522571 15:30417134-30417156 GAGATAAGATAGAGGGATGGAGG + Intergenic
1124536093 15:30549080-30549102 GAGATAAGATAGAGGGATGGAGG - Intergenic
1124776067 15:32590560-32590582 GAGATAAGATAGAGGGATGGAGG - Intergenic
1127159234 15:56164009-56164031 CTGATGAGGTAAAAGCATGGTGG + Intronic
1127438760 15:58985493-58985515 CAGATGAAATAAAAGGGTGAGGG - Intronic
1127465209 15:59237567-59237589 CATATCATATAAAATGATGGTGG + Intronic
1129020822 15:72516003-72516025 CATATTAAATAAAAACATGGTGG + Intronic
1130872798 15:87984481-87984503 CGGATTCAATAAAAGGATGGCGG + Intronic
1132495446 16:261077-261099 CAGATAGGAGAAAAGGAAGGGGG + Intronic
1133615404 16:7471641-7471663 CACATTAGATCAAAAAATGGGGG + Intronic
1135969235 16:27060349-27060371 CAGATAAAATAAAATGAGGGAGG - Intergenic
1137362716 16:47833977-47833999 TAGATTAGATAACAGGTTGGAGG + Intergenic
1137905001 16:52312112-52312134 TAGATTAGATAGATGGATGATGG + Intergenic
1139293686 16:65880581-65880603 CAGATTAGATTGAGGGGTGGGGG + Intergenic
1139435023 16:66931733-66931755 CTGATCAGATAAAAGTATTGTGG + Intergenic
1140303951 16:73784979-73785001 CAGATTAGTTAGAAACATGGAGG - Intergenic
1140681641 16:77390993-77391015 TAGAGTAGATGGAAGGATGGTGG - Intronic
1141202138 16:81906323-81906345 CACATTAGGTAAAGGGATAGAGG - Intronic
1141375799 16:83529030-83529052 CAGATTAGAAGAGAAGATGGAGG + Intronic
1143981499 17:10874034-10874056 CAGACTGGACAACAGGATGGTGG + Intergenic
1145920792 17:28607946-28607968 CAAATGAGATAAAAGGATAAAGG + Intronic
1146236012 17:31163203-31163225 GAGATTAGATGAAACGATGCTGG + Exonic
1146756526 17:35436940-35436962 CAGATTAGATAATAGTATCAGGG + Exonic
1148161050 17:45450277-45450299 TAGATTAGATAGATGGATGGTGG - Intronic
1148954003 17:51338292-51338314 AAGATTAGATACAAAGATAGAGG + Intergenic
1150517358 17:65827494-65827516 CAGATGAGAGGAAATGATGGTGG - Intronic
1150519501 17:65851723-65851745 GAGATTAAATATAAGGGTGGTGG + Intronic
1155041834 18:22071268-22071290 CTGACTAGAGAAAAGGATGTAGG - Intergenic
1155230077 18:23764242-23764264 CAGATAATATAAAAGTATGGAGG - Intronic
1156001648 18:32391504-32391526 CAGATTAGGTAAAAGTATATAGG + Intronic
1156279592 18:35622986-35623008 AAGATTAGAACAAAGAATGGAGG - Intronic
1156446317 18:37239590-37239612 CAGCTTAGAGAAATGGAGGGAGG + Intergenic
1157652957 18:49355010-49355032 CAGAGTAGATCAAAGGATGATGG - Intronic
1157652961 18:49355121-49355143 CAGAGTAGATCAAAGGATGATGG - Intronic
1158265389 18:55655939-55655961 CAAAATATATAAAATGATGGAGG - Intronic
1158665172 18:59426151-59426173 TAGATTAGAAAATTGGATGGTGG + Intergenic
1158671196 18:59475509-59475531 CAGAATAAACAAAAGTATGGAGG - Intronic
1158692339 18:59671783-59671805 CAGATTAGATAAAAGGATGGTGG + Intronic
1160596175 18:79975952-79975974 CACAGTAGAGAAAAGGATGAGGG + Intronic
1161100793 19:2420553-2420575 CACAGTAGTTAAAAGGAAGGTGG + Intronic
1162237549 19:9321006-9321028 CAGAGGAGAACAAAGGATGGAGG + Intergenic
1163976463 19:20857844-20857866 CAGATGAGAACAAAGGAAGGAGG - Intronic
1163983879 19:20926966-20926988 AAGATTAGAAAAAAGGTGGGAGG + Intronic
1165294755 19:34917535-34917557 CAGATGAGAACAAAGGAAGGAGG + Intergenic
926541385 2:14184139-14184161 AAGATTAGATAGATGGACGGAGG + Intergenic
927461925 2:23306753-23306775 CAGGTTACATACAAGGATGAAGG + Intergenic
935263435 2:101374813-101374835 CAGTATAGTTAAAAAGATGGAGG + Intronic
937672888 2:124557742-124557764 CACATTAAATAACATGATGGTGG + Intronic
937726576 2:125174427-125174449 CAGAATAGAACAAAGGAAGGAGG - Intergenic
939308398 2:140438806-140438828 TAGATTAGATGAAAGGATGCAGG + Intronic
940450813 2:153834289-153834311 CAGATAATATAAAAGAATGAAGG + Intergenic
940728758 2:157365231-157365253 AAGATTAGATAATATGTTGGTGG - Intergenic
941249012 2:163138420-163138442 CAGGTTAGATAAAGAAATGGAGG + Intergenic
942627948 2:177923474-177923496 CAGCTGAGATAAAAGGAGGATGG - Intronic
943160986 2:184250926-184250948 CACATTAGTTCAAAGTATGGAGG - Intergenic
944535349 2:200704300-200704322 CAGCTGAGATGAAAGGAAGGGGG + Intergenic
945872307 2:215241112-215241134 CAGATTAGGTAAAATGATTTTGG - Intergenic
1169418291 20:5436815-5436837 CAAAATAAATAAAATGATGGTGG - Intergenic
1170226887 20:14000502-14000524 CAGTTTAGATAAATGGATGCAGG - Intronic
1171107185 20:22445601-22445623 AAGATAAGGGAAAAGGATGGGGG + Intergenic
1173111905 20:40198817-40198839 GAGAATAGATAAAAGCATGTGGG - Intergenic
1173273886 20:41561486-41561508 CAGATTAGAGACAATGATGAAGG - Intronic
1176954352 21:15083774-15083796 CAAATTAGCTCAAAGCATGGTGG - Intergenic
1177244249 21:18502219-18502241 CAGAGGAGATAGAGGGATGGAGG + Intergenic
1177564408 21:22799537-22799559 GATATTAGATACAAGGATAGTGG - Intergenic
1178187726 21:30243071-30243093 CAGATTTAATAAAAGTATGAAGG - Intergenic
1180673064 22:17568384-17568406 CAGATGAGAATAAAGGAAGGAGG + Intronic
1182325497 22:29509555-29509577 CAGATGAGGTGAAAGGATGCTGG + Intronic
1184608807 22:45589749-45589771 CAGATGAGAGTAAAGGAGGGAGG - Intronic
951697403 3:25460031-25460053 GTGGTTAGATAACAGGATGGAGG + Intronic
952654985 3:35774829-35774851 AAGATTTGATAAAAGTATTGAGG - Intronic
953386863 3:42511536-42511558 CAGAAGAGAGTAAAGGATGGTGG + Intronic
954358022 3:50098897-50098919 GAGATTAGACTAAAGGATGGAGG + Intronic
954544150 3:51418441-51418463 TAGAATAGATAAAAGGGAGGGGG + Intronic
955313999 3:57920018-57920040 CAGACTAGATGTAAGAATGGTGG + Intronic
956655164 3:71542862-71542884 CAGATAACACAAAAGCATGGAGG + Intronic
957080947 3:75634918-75634940 CAGTTGAGGTAAGAGGATGGGGG + Intergenic
957564679 3:81868639-81868661 TAGATTAGATAAAATTCTGGAGG + Intergenic
957679941 3:83420883-83420905 CAAATGAGATAAATGGATTGGGG - Intergenic
959278990 3:104312909-104312931 CAAAATAGATGAAAGGATAGAGG + Intergenic
962277664 3:134028616-134028638 CAGATTACACAAAGGGATGATGG - Intronic
964640254 3:158902014-158902036 GAGATTAGATAAACTGTTGGAGG + Intergenic
965580035 3:170258056-170258078 CAGAGAAGATAAAAGGAAGTAGG + Intronic
966540748 3:181087325-181087347 AAGATTTGATAAAGGGATGGAGG + Intergenic
967311698 3:188112209-188112231 CTGAGTAGATGAAAGGATGAAGG - Intergenic
969220600 4:5756152-5756174 CAGGTTAGAAAGAAGGATGTTGG - Intronic
971443334 4:26714449-26714471 GAGATTAGTTAAAAGGAGGATGG - Intronic
971551338 4:27960643-27960665 CAGAGCAGAGAAAAGAATGGTGG + Intergenic
972655111 4:41056579-41056601 CAGATGAGATATAAGAATTGAGG + Intronic
972692168 4:41410081-41410103 CAGTTTACATAAAAGGATTTGGG - Intronic
975256332 4:72240057-72240079 AAGATTAAACAAAAGGAAGGAGG + Intergenic
976862706 4:89685565-89685587 CAGATTAGATAAAAAGAGTTGGG - Intergenic
977850418 4:101820847-101820869 CAGATTGGATAAAAAGAATGTGG - Intronic
978369093 4:108012592-108012614 CAGATGAGAACAAAGGAAGGAGG + Intronic
978815913 4:112905485-112905507 AAGATAAGATAAAAGGAGTGGGG + Intronic
979888799 4:126064152-126064174 CAGAGGAGAAAAAAGGAAGGAGG + Intergenic
979907865 4:126319027-126319049 CAGATTAGAGACAACAATGGAGG - Intergenic
980003084 4:127512987-127513009 CAGCTTATATAACAGCATGGTGG + Intergenic
980235036 4:130094202-130094224 CAAATAAGCTAATAGGATGGAGG - Intergenic
980402755 4:132313877-132313899 CAGATAAAATAAAAAGGTGGAGG - Intergenic
980429114 4:132667430-132667452 CAGATTAGATGAGAACATGGAGG + Intergenic
980955073 4:139419676-139419698 CAGCTTTGATAAAAGCTTGGAGG - Intronic
983768932 4:171523596-171523618 CAAATTAGATAATAGGTTAGAGG - Intergenic
984143503 4:176032985-176033007 CAGATTAGATGAATGGGTGGAGG + Intergenic
985449944 4:190056218-190056240 CAGTTGAGGTAAGAGGATGGGGG - Intergenic
987554357 5:19428036-19428058 CAGAATATATAAAACGGTGGTGG - Intergenic
988255446 5:28813811-28813833 CAAATTCGATAAATGCATGGGGG + Intergenic
989280870 5:39641867-39641889 CAGATTATGAAAAAGTATGGGGG + Intergenic
990326357 5:54679657-54679679 CAGTTTAAATAAAATTATGGCGG + Intergenic
993453531 5:88101106-88101128 CAGAGGAGAGAAAAGGGTGGGGG - Intergenic
994356125 5:98795617-98795639 CAGCTTCTATAAAAGGAAGGCGG - Exonic
997751076 5:136346444-136346466 CAGAACAGATAAAAGGAGGGAGG - Intronic
998234158 5:140383487-140383509 CAGCCTTGATAAAAGGAAGGAGG + Intergenic
1003150384 6:3543000-3543022 CAGATTAAATCCAATGATGGAGG - Intergenic
1003547445 6:7071924-7071946 CAGAATCGCTAAAAGGATGGAGG + Intergenic
1004119765 6:12809462-12809484 CAGTTTGGATAAATGGATAGTGG - Intronic
1006143738 6:31946058-31946080 CAGATTGTATAAAAGGCTGGGGG + Exonic
1008647584 6:53530842-53530864 AAGAATAGAGAAAGGGATGGTGG - Intronic
1010474487 6:76269530-76269552 CAGATTAAAAAAAAAGATGTTGG + Intergenic
1010846518 6:80715831-80715853 TAGATGAGAAAAAATGATGGAGG + Intergenic
1011056406 6:83208487-83208509 CAGATCAGATAAAGAGAAGGTGG + Intergenic
1011209395 6:84938271-84938293 CACATGAAATAAAGGGATGGAGG + Intergenic
1011381205 6:86744017-86744039 CAAATCAGATAATAAGATGGGGG - Intergenic
1012750001 6:103147848-103147870 CAGATTGGGGATAAGGATGGGGG + Intergenic
1012757841 6:103254340-103254362 TATATTAGGTAAAAAGATGGTGG + Intergenic
1015097455 6:129432615-129432637 CAGATAACATAAAGGGATGGTGG + Intronic
1015560831 6:134513653-134513675 CAAATTAGAAATAAAGATGGGGG + Intergenic
1016532516 6:145074805-145074827 CAAATTATATAATAGGAGGGAGG + Intergenic
1016622290 6:146125693-146125715 CAGAATGGAGAAAAGGAGGGGGG - Intronic
1017305738 6:152916446-152916468 AAGCTGAAATAAAAGGATGGGGG - Intergenic
1018785891 6:167107849-167107871 CAGATTAGTTAAAAGGCAGTGGG - Intergenic
1019847884 7:3524803-3524825 CAGATTAGAAAAAAAATTGGAGG + Intronic
1020650036 7:10863501-10863523 AAAATTAGATAAAAGGATTATGG - Intergenic
1021320292 7:19201572-19201594 CATGATAGATAAAAGGATGTGGG + Intergenic
1021475895 7:21060142-21060164 CAGATTAGAAATAGGGATGGGGG + Intergenic
1023082413 7:36537846-36537868 CAGATGTGATAAAAGCAGGGTGG + Intronic
1023164674 7:37331757-37331779 CTGATTGGATAAAAAGATGAGGG + Intronic
1024229100 7:47350453-47350475 CAGTCTAGAGAAAAGGAAGGAGG + Intronic
1026264777 7:68786658-68786680 TAGATTAAATTAAAAGATGGAGG + Intergenic
1027683958 7:81257654-81257676 CAAATTAGAAAATAGAATGGTGG + Intergenic
1028335920 7:89654791-89654813 CAATTTAGATAAAAGTATGCTGG - Intergenic
1028483525 7:91333959-91333981 GAGGTAAGATTAAAGGATGGAGG + Intergenic
1028882562 7:95896259-95896281 CAGTTTAGCTTAAAGGAAGGTGG + Intronic
1029130492 7:98326633-98326655 CAGATTAGAAAAAAGAAATGGGG + Intronic
1029344195 7:99966767-99966789 CAGATTAGACAATGGGGTGGGGG + Exonic
1029972246 7:104800977-104800999 CAGATTAGAAAAAATGAGGGAGG + Intronic
1030957239 7:115869201-115869223 AATGTTAGATAAAAGGGTGGTGG - Intergenic
1031354914 7:120778655-120778677 CAGCTTATATAACAGCATGGTGG + Intergenic
1031406436 7:121392990-121393012 CAGAATAGATAAATTTATGGGGG + Intronic
1033970390 7:147032299-147032321 CAGATTTGATAAATGCATAGTGG - Intronic
1033980940 7:147165117-147165139 CTGTTTTGATAAAAGGATGTTGG - Intronic
1037661941 8:20935289-20935311 CAGGTGAGAAAAAGGGATGGAGG - Intergenic
1038003106 8:23407137-23407159 CAGATGAAACAAAATGATGGCGG + Intronic
1039249917 8:35651336-35651358 CATAAAAGATAAAAGGATGAAGG + Intronic
1043303065 8:78759062-78759084 CAGATTAAAAAAAAAGGTGGGGG - Intronic
1048092826 8:131259722-131259744 CACATTAGATAAAAGGAATAAGG + Intergenic
1052472781 9:28921303-28921325 GATATGAGAGAAAAGGATGGAGG - Intergenic
1058210758 9:102167016-102167038 AAGTTTAGGTAAAAGGATCGAGG + Intergenic
1059973569 9:119692641-119692663 CATGTTAGAGAAAAGGATGGTGG + Intergenic
1186209495 X:7234477-7234499 CAGAGCAAATAAAAGGGTGGTGG + Intronic
1187639392 X:21272225-21272247 CAAATTAGAAAAATGGATGGTGG + Intergenic
1187728815 X:22232652-22232674 CAAAATAAATAAAGGGATGGAGG - Intronic
1187966889 X:24620708-24620730 AACATTAGCTCAAAGGATGGAGG + Intronic
1188222919 X:27562184-27562206 AATATTAGATAAAAGGATAGTGG - Intergenic
1188224971 X:27586141-27586163 GAAATAAGATAAAAGGAGGGTGG - Intergenic
1190578055 X:51861132-51861154 TAGAATAGATCAAAAGATGGTGG - Intronic
1191952118 X:66603978-66604000 ACGATTAGATAAATGGATAGTGG + Intronic
1193809006 X:86029374-86029396 CAGCTTAGTTAAAAGGATAATGG + Intronic
1194406476 X:93502493-93502515 CAGATTAGATAAAGAAATTGTGG + Intergenic
1194773060 X:97928412-97928434 CAGATTACCTTCAAGGATGGAGG + Intergenic
1195698165 X:107682205-107682227 GAGAGTAGATAAATGGATTGAGG + Intergenic
1196226405 X:113172566-113172588 CAGATAAAACAAAAAGATGGAGG + Intergenic
1196536120 X:116846442-116846464 CAGTTAAGATAATAAGATGGTGG - Intergenic
1196728009 X:118914554-118914576 CAGTTTAGAAGAAGGGATGGGGG - Intergenic
1197265613 X:124367136-124367158 CAGATCAGACAACAGGATGAGGG - Intronic
1197633132 X:128885132-128885154 CAGATTTGAAAATAGGATGTGGG + Intergenic
1197822504 X:130555266-130555288 CTGATTAGATAAAAACATGATGG + Intergenic
1198775558 X:140175648-140175670 CAGATTTGAAAAAGGGGTGGAGG - Intergenic