ID: 1158696568

View in Genome Browser
Species Human (GRCh38)
Location 18:59709079-59709101
Sequence TAGGGTATACAAAAGGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158696563_1158696568 -4 Left 1158696563 18:59709060-59709082 CCAAATGGAGGCGGAAGAATAGG No data
Right 1158696568 18:59709079-59709101 TAGGGTATACAAAAGGTTCTGGG No data
1158696562_1158696568 -3 Left 1158696562 18:59709059-59709081 CCCAAATGGAGGCGGAAGAATAG No data
Right 1158696568 18:59709079-59709101 TAGGGTATACAAAAGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158696568 Original CRISPR TAGGGTATACAAAAGGTTCT GGG Intergenic
No off target data available for this crispr