ID: 1158696568 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:59709079-59709101 |
Sequence | TAGGGTATACAAAAGGTTCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1158696563_1158696568 | -4 | Left | 1158696563 | 18:59709060-59709082 | CCAAATGGAGGCGGAAGAATAGG | No data | ||
Right | 1158696568 | 18:59709079-59709101 | TAGGGTATACAAAAGGTTCTGGG | No data | ||||
1158696562_1158696568 | -3 | Left | 1158696562 | 18:59709059-59709081 | CCCAAATGGAGGCGGAAGAATAG | No data | ||
Right | 1158696568 | 18:59709079-59709101 | TAGGGTATACAAAAGGTTCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1158696568 | Original CRISPR | TAGGGTATACAAAAGGTTCT GGG | Intergenic | ||
No off target data available for this crispr |