ID: 1158703492

View in Genome Browser
Species Human (GRCh38)
Location 18:59770467-59770489
Sequence CTGTAGTCCTTGAAGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158703488_1158703492 1 Left 1158703488 18:59770443-59770465 CCTGACATGGGTAAACAGCAGCT No data
Right 1158703492 18:59770467-59770489 CTGTAGTCCTTGAAGGGAGAAGG No data
1158703483_1158703492 26 Left 1158703483 18:59770418-59770440 CCATTTGCTCCAAGGTTCCTCTG No data
Right 1158703492 18:59770467-59770489 CTGTAGTCCTTGAAGGGAGAAGG No data
1158703487_1158703492 9 Left 1158703487 18:59770435-59770457 CCTCTGAGCCTGACATGGGTAAA No data
Right 1158703492 18:59770467-59770489 CTGTAGTCCTTGAAGGGAGAAGG No data
1158703484_1158703492 17 Left 1158703484 18:59770427-59770449 CCAAGGTTCCTCTGAGCCTGACA No data
Right 1158703492 18:59770467-59770489 CTGTAGTCCTTGAAGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158703492 Original CRISPR CTGTAGTCCTTGAAGGGAGA AGG Intergenic
No off target data available for this crispr