ID: 1158704457

View in Genome Browser
Species Human (GRCh38)
Location 18:59779301-59779323
Sequence CACAGTCAGCAACTGTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158704452_1158704457 16 Left 1158704452 18:59779262-59779284 CCATCTGGCTGTGCAGCCTTGCT No data
Right 1158704457 18:59779301-59779323 CACAGTCAGCAACTGTTGCCAGG No data
1158704454_1158704457 0 Left 1158704454 18:59779278-59779300 CCTTGCTCTGTGGCTCTTCCCAA No data
Right 1158704457 18:59779301-59779323 CACAGTCAGCAACTGTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158704457 Original CRISPR CACAGTCAGCAACTGTTGCC AGG Intergenic
No off target data available for this crispr