ID: 1158706962

View in Genome Browser
Species Human (GRCh38)
Location 18:59801460-59801482
Sequence CTGTCCCCCAAGCTGGAGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12765
Summary {0: 3, 1: 26, 2: 638, 3: 5195, 4: 6903}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158706955_1158706962 24 Left 1158706955 18:59801413-59801435 CCATTTCCTTGCCTTGTTCAGCT No data
Right 1158706962 18:59801460-59801482 CTGTCCCCCAAGCTGGAGTACGG 0: 3
1: 26
2: 638
3: 5195
4: 6903
1158706957_1158706962 13 Left 1158706957 18:59801424-59801446 CCTTGTTCAGCTTTTTTTTTGAG No data
Right 1158706962 18:59801460-59801482 CTGTCCCCCAAGCTGGAGTACGG 0: 3
1: 26
2: 638
3: 5195
4: 6903
1158706956_1158706962 18 Left 1158706956 18:59801419-59801441 CCTTGCCTTGTTCAGCTTTTTTT No data
Right 1158706962 18:59801460-59801482 CTGTCCCCCAAGCTGGAGTACGG 0: 3
1: 26
2: 638
3: 5195
4: 6903

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158706962 Original CRISPR CTGTCCCCCAAGCTGGAGTA CGG Intergenic
Too many off-targets to display for this crispr