ID: 1158707831

View in Genome Browser
Species Human (GRCh38)
Location 18:59809638-59809660
Sequence ACTGCCTTACCACCCTACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158707831_1158707836 14 Left 1158707831 18:59809638-59809660 CCTAGGTAGGGTGGTAAGGCAGT No data
Right 1158707836 18:59809675-59809697 AGAAGTTCAGTCTTTAGGCCGGG No data
1158707831_1158707837 22 Left 1158707831 18:59809638-59809660 CCTAGGTAGGGTGGTAAGGCAGT No data
Right 1158707837 18:59809683-59809705 AGTCTTTAGGCCGGGTGCAGTGG No data
1158707831_1158707835 13 Left 1158707831 18:59809638-59809660 CCTAGGTAGGGTGGTAAGGCAGT No data
Right 1158707835 18:59809674-59809696 TAGAAGTTCAGTCTTTAGGCCGG No data
1158707831_1158707834 9 Left 1158707831 18:59809638-59809660 CCTAGGTAGGGTGGTAAGGCAGT No data
Right 1158707834 18:59809670-59809692 TGGTTAGAAGTTCAGTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158707831 Original CRISPR ACTGCCTTACCACCCTACCT AGG (reversed) Intergenic
No off target data available for this crispr