ID: 1158707834

View in Genome Browser
Species Human (GRCh38)
Location 18:59809670-59809692
Sequence TGGTTAGAAGTTCAGTCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158707831_1158707834 9 Left 1158707831 18:59809638-59809660 CCTAGGTAGGGTGGTAAGGCAGT No data
Right 1158707834 18:59809670-59809692 TGGTTAGAAGTTCAGTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158707834 Original CRISPR TGGTTAGAAGTTCAGTCTTT AGG Intergenic
No off target data available for this crispr