ID: 1158709270

View in Genome Browser
Species Human (GRCh38)
Location 18:59822934-59822956
Sequence CTAATCAGTCTGGGGTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158709264_1158709270 22 Left 1158709264 18:59822889-59822911 CCTTATGGCTTCATCTTCCTAAT No data
Right 1158709270 18:59822934-59822956 CTAATCAGTCTGGGGTAAGAGGG No data
1158709265_1158709270 5 Left 1158709265 18:59822906-59822928 CCTAATTATGTTTATTTTGATAA No data
Right 1158709270 18:59822934-59822956 CTAATCAGTCTGGGGTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158709270 Original CRISPR CTAATCAGTCTGGGGTAAGA GGG Intergenic