ID: 1158713063

View in Genome Browser
Species Human (GRCh38)
Location 18:59854321-59854343
Sequence CTCAAACACCAGAATCAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158713055_1158713063 29 Left 1158713055 18:59854269-59854291 CCTGCGTAAAATTATGTGTCCCC No data
Right 1158713063 18:59854321-59854343 CTCAAACACCAGAATCAACAGGG No data
1158713059_1158713063 9 Left 1158713059 18:59854289-59854311 CCCTGATAGCGGAATTGACTGGA No data
Right 1158713063 18:59854321-59854343 CTCAAACACCAGAATCAACAGGG No data
1158713057_1158713063 10 Left 1158713057 18:59854288-59854310 CCCCTGATAGCGGAATTGACTGG No data
Right 1158713063 18:59854321-59854343 CTCAAACACCAGAATCAACAGGG No data
1158713060_1158713063 8 Left 1158713060 18:59854290-59854312 CCTGATAGCGGAATTGACTGGAG No data
Right 1158713063 18:59854321-59854343 CTCAAACACCAGAATCAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158713063 Original CRISPR CTCAAACACCAGAATCAACA GGG Intergenic
No off target data available for this crispr