ID: 1158713442

View in Genome Browser
Species Human (GRCh38)
Location 18:59857677-59857699
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158713442_1158713448 -10 Left 1158713442 18:59857677-59857699 CCCTCTGTAGACTCCTCAGTGTC No data
Right 1158713448 18:59857690-59857712 CCTCAGTGTCATCAAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158713442 Original CRISPR GACACTGAGGAGTCTACAGA GGG (reversed) Intergenic
No off target data available for this crispr