ID: 1158713775

View in Genome Browser
Species Human (GRCh38)
Location 18:59860183-59860205
Sequence CAGCTGTCCTGGAAGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158713775_1158713779 23 Left 1158713775 18:59860183-59860205 CCATCTGTCTTCCAGGACAGCTG No data
Right 1158713779 18:59860229-59860251 CATGCATCATTTGAGGCATTGGG No data
1158713775_1158713777 16 Left 1158713775 18:59860183-59860205 CCATCTGTCTTCCAGGACAGCTG No data
Right 1158713777 18:59860222-59860244 TCTTAAGCATGCATCATTTGAGG No data
1158713775_1158713778 22 Left 1158713775 18:59860183-59860205 CCATCTGTCTTCCAGGACAGCTG No data
Right 1158713778 18:59860228-59860250 GCATGCATCATTTGAGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158713775 Original CRISPR CAGCTGTCCTGGAAGACAGA TGG (reversed) Intergenic
No off target data available for this crispr