ID: 1158714669

View in Genome Browser
Species Human (GRCh38)
Location 18:59867521-59867543
Sequence GGGTGTGAGGGGGTGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158714669_1158714678 -3 Left 1158714669 18:59867521-59867543 CCCAGCACCACCCCCTCACACCC No data
Right 1158714678 18:59867541-59867563 CCCCCTTCGTGTTTACCTCTGGG No data
1158714669_1158714676 -4 Left 1158714669 18:59867521-59867543 CCCAGCACCACCCCCTCACACCC No data
Right 1158714676 18:59867540-59867562 ACCCCCTTCGTGTTTACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158714669 Original CRISPR GGGTGTGAGGGGGTGGTGCT GGG (reversed) Intergenic
No off target data available for this crispr