ID: 1158716984

View in Genome Browser
Species Human (GRCh38)
Location 18:59889314-59889336
Sequence CAGCGAGAATAGATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158716981_1158716984 15 Left 1158716981 18:59889276-59889298 CCTGGGAACATTTGAATTAAAGA No data
Right 1158716984 18:59889314-59889336 CAGCGAGAATAGATGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158716984 Original CRISPR CAGCGAGAATAGATGGAAAA AGG Intergenic
No off target data available for this crispr