ID: 1158720989

View in Genome Browser
Species Human (GRCh38)
Location 18:59924365-59924387
Sequence TTAGTTAATTTGCAGTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158720989_1158720990 10 Left 1158720989 18:59924365-59924387 CCAAACAACTGCAAATTAACTAA No data
Right 1158720990 18:59924398-59924420 TTAATTCTGAATTTTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158720989 Original CRISPR TTAGTTAATTTGCAGTTGTT TGG (reversed) Intergenic
No off target data available for this crispr