ID: 1158726141

View in Genome Browser
Species Human (GRCh38)
Location 18:59974477-59974499
Sequence GGAGCATTGCATCTAATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158726141_1158726144 1 Left 1158726141 18:59974477-59974499 CCCAGAATTAGATGCAATGCTCC No data
Right 1158726144 18:59974501-59974523 GATGTTGATATCGTACATGATGG No data
1158726141_1158726145 2 Left 1158726141 18:59974477-59974499 CCCAGAATTAGATGCAATGCTCC No data
Right 1158726145 18:59974502-59974524 ATGTTGATATCGTACATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158726141 Original CRISPR GGAGCATTGCATCTAATTCT GGG (reversed) Intergenic
No off target data available for this crispr