ID: 1158727515

View in Genome Browser
Species Human (GRCh38)
Location 18:59986997-59987019
Sequence ACATTCCCACATATACAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158727515_1158727519 3 Left 1158727515 18:59986997-59987019 CCATGCTGTATATGTGGGAATGT No data
Right 1158727519 18:59987023-59987045 AGGCATTGTGCTGGGTACTATGG No data
1158727515_1158727517 -6 Left 1158727515 18:59986997-59987019 CCATGCTGTATATGTGGGAATGT No data
Right 1158727517 18:59987014-59987036 GAATGTATCAGGCATTGTGCTGG No data
1158727515_1158727520 24 Left 1158727515 18:59986997-59987019 CCATGCTGTATATGTGGGAATGT No data
Right 1158727520 18:59987044-59987066 GGATAGAGTAGAGAACAAAATGG No data
1158727515_1158727518 -5 Left 1158727515 18:59986997-59987019 CCATGCTGTATATGTGGGAATGT No data
Right 1158727518 18:59987015-59987037 AATGTATCAGGCATTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158727515 Original CRISPR ACATTCCCACATATACAGCA TGG (reversed) Intergenic
No off target data available for this crispr