ID: 1158731511

View in Genome Browser
Species Human (GRCh38)
Location 18:60029409-60029431
Sequence TGGTATATTCATAAAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158731511_1158731514 15 Left 1158731511 18:60029409-60029431 CCATCCATTTTATGAATATACCA No data
Right 1158731514 18:60029447-60029469 GTCACCTGTTGACAGACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158731511 Original CRISPR TGGTATATTCATAAAATGGA TGG (reversed) Intergenic
No off target data available for this crispr