ID: 1158733050

View in Genome Browser
Species Human (GRCh38)
Location 18:60046922-60046944
Sequence CTGTGAGTAAGTGAAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158733046_1158733050 23 Left 1158733046 18:60046876-60046898 CCCCTTTTCTGGCATTTTCTTTA No data
Right 1158733050 18:60046922-60046944 CTGTGAGTAAGTGAAGAAGATGG No data
1158733048_1158733050 21 Left 1158733048 18:60046878-60046900 CCTTTTCTGGCATTTTCTTTACA No data
Right 1158733050 18:60046922-60046944 CTGTGAGTAAGTGAAGAAGATGG No data
1158733045_1158733050 24 Left 1158733045 18:60046875-60046897 CCCCCTTTTCTGGCATTTTCTTT No data
Right 1158733050 18:60046922-60046944 CTGTGAGTAAGTGAAGAAGATGG No data
1158733047_1158733050 22 Left 1158733047 18:60046877-60046899 CCCTTTTCTGGCATTTTCTTTAC No data
Right 1158733050 18:60046922-60046944 CTGTGAGTAAGTGAAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158733050 Original CRISPR CTGTGAGTAAGTGAAGAAGA TGG Intergenic
No off target data available for this crispr