ID: 1158734169

View in Genome Browser
Species Human (GRCh38)
Location 18:60060995-60061017
Sequence CTTTCTAGGTGGAGGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158734158_1158734169 2 Left 1158734158 18:60060970-60060992 CCTGATCTCTTTCCAGGGAAGAC No data
Right 1158734169 18:60060995-60061017 CTTTCTAGGTGGAGGGGGGCGGG No data
1158734160_1158734169 -10 Left 1158734160 18:60060982-60061004 CCAGGGAAGACCTCTTTCTAGGT No data
Right 1158734169 18:60060995-60061017 CTTTCTAGGTGGAGGGGGGCGGG No data
1158734154_1158734169 28 Left 1158734154 18:60060944-60060966 CCACTGCATTCGGTTGGGCACAG No data
Right 1158734169 18:60060995-60061017 CTTTCTAGGTGGAGGGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158734169 Original CRISPR CTTTCTAGGTGGAGGGGGGC GGG Intergenic
No off target data available for this crispr