ID: 1158734526

View in Genome Browser
Species Human (GRCh38)
Location 18:60064477-60064499
Sequence CAGATTTACCCCAGGCACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158734526_1158734529 -3 Left 1158734526 18:60064477-60064499 CCAGTGTGCCTGGGGTAAATCTG No data
Right 1158734529 18:60064497-60064519 CTGCAGAACCAAGGAAGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158734526 Original CRISPR CAGATTTACCCCAGGCACAC TGG (reversed) Intergenic
No off target data available for this crispr