ID: 1158739196

View in Genome Browser
Species Human (GRCh38)
Location 18:60120362-60120384
Sequence TTAGAGGGAGATGGGGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158739196_1158739208 30 Left 1158739196 18:60120362-60120384 CCCCATCCCCCATCTCCCTCTAA No data
Right 1158739208 18:60120415-60120437 CCACTTGATGAATAACCACTGGG No data
1158739196_1158739205 -3 Left 1158739196 18:60120362-60120384 CCCCATCCCCCATCTCCCTCTAA No data
Right 1158739205 18:60120382-60120404 TAATGCTATCACATGTTTATAGG No data
1158739196_1158739206 29 Left 1158739196 18:60120362-60120384 CCCCATCCCCCATCTCCCTCTAA No data
Right 1158739206 18:60120414-60120436 TCCACTTGATGAATAACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158739196 Original CRISPR TTAGAGGGAGATGGGGGATG GGG (reversed) Intergenic
No off target data available for this crispr