ID: 1158739202

View in Genome Browser
Species Human (GRCh38)
Location 18:60120371-60120393
Sequence GTGATAGCATTAGAGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158739202_1158739209 22 Left 1158739202 18:60120371-60120393 CCATCTCCCTCTAATGCTATCAC No data
Right 1158739209 18:60120416-60120438 CACTTGATGAATAACCACTGGGG No data
1158739202_1158739208 21 Left 1158739202 18:60120371-60120393 CCATCTCCCTCTAATGCTATCAC No data
Right 1158739208 18:60120415-60120437 CCACTTGATGAATAACCACTGGG No data
1158739202_1158739210 29 Left 1158739202 18:60120371-60120393 CCATCTCCCTCTAATGCTATCAC No data
Right 1158739210 18:60120423-60120445 TGAATAACCACTGGGGACAAAGG No data
1158739202_1158739206 20 Left 1158739202 18:60120371-60120393 CCATCTCCCTCTAATGCTATCAC No data
Right 1158739206 18:60120414-60120436 TCCACTTGATGAATAACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158739202 Original CRISPR GTGATAGCATTAGAGGGAGA TGG (reversed) Intergenic
No off target data available for this crispr