ID: 1158739205

View in Genome Browser
Species Human (GRCh38)
Location 18:60120382-60120404
Sequence TAATGCTATCACATGTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158739195_1158739205 23 Left 1158739195 18:60120336-60120358 CCTCTAATGCTATTGTTGCTCTC No data
Right 1158739205 18:60120382-60120404 TAATGCTATCACATGTTTATAGG No data
1158739193_1158739205 30 Left 1158739193 18:60120329-60120351 CCATCTCCCTCTAATGCTATTGT No data
Right 1158739205 18:60120382-60120404 TAATGCTATCACATGTTTATAGG No data
1158739194_1158739205 24 Left 1158739194 18:60120335-60120357 CCCTCTAATGCTATTGTTGCTCT No data
Right 1158739205 18:60120382-60120404 TAATGCTATCACATGTTTATAGG No data
1158739197_1158739205 -4 Left 1158739197 18:60120363-60120385 CCCATCCCCCATCTCCCTCTAAT No data
Right 1158739205 18:60120382-60120404 TAATGCTATCACATGTTTATAGG No data
1158739196_1158739205 -3 Left 1158739196 18:60120362-60120384 CCCCATCCCCCATCTCCCTCTAA No data
Right 1158739205 18:60120382-60120404 TAATGCTATCACATGTTTATAGG No data
1158739199_1158739205 -9 Left 1158739199 18:60120368-60120390 CCCCCATCTCCCTCTAATGCTAT No data
Right 1158739205 18:60120382-60120404 TAATGCTATCACATGTTTATAGG No data
1158739198_1158739205 -5 Left 1158739198 18:60120364-60120386 CCATCCCCCATCTCCCTCTAATG No data
Right 1158739205 18:60120382-60120404 TAATGCTATCACATGTTTATAGG No data
1158739200_1158739205 -10 Left 1158739200 18:60120369-60120391 CCCCATCTCCCTCTAATGCTATC No data
Right 1158739205 18:60120382-60120404 TAATGCTATCACATGTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158739205 Original CRISPR TAATGCTATCACATGTTTAT AGG Intergenic
No off target data available for this crispr