ID: 1158739206

View in Genome Browser
Species Human (GRCh38)
Location 18:60120414-60120436
Sequence TCCACTTGATGAATAACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158739197_1158739206 28 Left 1158739197 18:60120363-60120385 CCCATCCCCCATCTCCCTCTAAT No data
Right 1158739206 18:60120414-60120436 TCCACTTGATGAATAACCACTGG No data
1158739203_1158739206 14 Left 1158739203 18:60120377-60120399 CCCTCTAATGCTATCACATGTTT No data
Right 1158739206 18:60120414-60120436 TCCACTTGATGAATAACCACTGG No data
1158739198_1158739206 27 Left 1158739198 18:60120364-60120386 CCATCCCCCATCTCCCTCTAATG No data
Right 1158739206 18:60120414-60120436 TCCACTTGATGAATAACCACTGG No data
1158739202_1158739206 20 Left 1158739202 18:60120371-60120393 CCATCTCCCTCTAATGCTATCAC No data
Right 1158739206 18:60120414-60120436 TCCACTTGATGAATAACCACTGG No data
1158739200_1158739206 22 Left 1158739200 18:60120369-60120391 CCCCATCTCCCTCTAATGCTATC No data
Right 1158739206 18:60120414-60120436 TCCACTTGATGAATAACCACTGG No data
1158739201_1158739206 21 Left 1158739201 18:60120370-60120392 CCCATCTCCCTCTAATGCTATCA No data
Right 1158739206 18:60120414-60120436 TCCACTTGATGAATAACCACTGG No data
1158739199_1158739206 23 Left 1158739199 18:60120368-60120390 CCCCCATCTCCCTCTAATGCTAT No data
Right 1158739206 18:60120414-60120436 TCCACTTGATGAATAACCACTGG No data
1158739204_1158739206 13 Left 1158739204 18:60120378-60120400 CCTCTAATGCTATCACATGTTTA No data
Right 1158739206 18:60120414-60120436 TCCACTTGATGAATAACCACTGG No data
1158739196_1158739206 29 Left 1158739196 18:60120362-60120384 CCCCATCCCCCATCTCCCTCTAA No data
Right 1158739206 18:60120414-60120436 TCCACTTGATGAATAACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158739206 Original CRISPR TCCACTTGATGAATAACCAC TGG Intergenic
No off target data available for this crispr