ID: 1158739209

View in Genome Browser
Species Human (GRCh38)
Location 18:60120416-60120438
Sequence CACTTGATGAATAACCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158739200_1158739209 24 Left 1158739200 18:60120369-60120391 CCCCATCTCCCTCTAATGCTATC No data
Right 1158739209 18:60120416-60120438 CACTTGATGAATAACCACTGGGG No data
1158739204_1158739209 15 Left 1158739204 18:60120378-60120400 CCTCTAATGCTATCACATGTTTA No data
Right 1158739209 18:60120416-60120438 CACTTGATGAATAACCACTGGGG No data
1158739201_1158739209 23 Left 1158739201 18:60120370-60120392 CCCATCTCCCTCTAATGCTATCA No data
Right 1158739209 18:60120416-60120438 CACTTGATGAATAACCACTGGGG No data
1158739197_1158739209 30 Left 1158739197 18:60120363-60120385 CCCATCCCCCATCTCCCTCTAAT No data
Right 1158739209 18:60120416-60120438 CACTTGATGAATAACCACTGGGG No data
1158739198_1158739209 29 Left 1158739198 18:60120364-60120386 CCATCCCCCATCTCCCTCTAATG No data
Right 1158739209 18:60120416-60120438 CACTTGATGAATAACCACTGGGG No data
1158739202_1158739209 22 Left 1158739202 18:60120371-60120393 CCATCTCCCTCTAATGCTATCAC No data
Right 1158739209 18:60120416-60120438 CACTTGATGAATAACCACTGGGG No data
1158739199_1158739209 25 Left 1158739199 18:60120368-60120390 CCCCCATCTCCCTCTAATGCTAT No data
Right 1158739209 18:60120416-60120438 CACTTGATGAATAACCACTGGGG No data
1158739203_1158739209 16 Left 1158739203 18:60120377-60120399 CCCTCTAATGCTATCACATGTTT No data
Right 1158739209 18:60120416-60120438 CACTTGATGAATAACCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158739209 Original CRISPR CACTTGATGAATAACCACTG GGG Intergenic
No off target data available for this crispr