ID: 1158739210

View in Genome Browser
Species Human (GRCh38)
Location 18:60120423-60120445
Sequence TGAATAACCACTGGGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158739202_1158739210 29 Left 1158739202 18:60120371-60120393 CCATCTCCCTCTAATGCTATCAC No data
Right 1158739210 18:60120423-60120445 TGAATAACCACTGGGGACAAAGG No data
1158739201_1158739210 30 Left 1158739201 18:60120370-60120392 CCCATCTCCCTCTAATGCTATCA No data
Right 1158739210 18:60120423-60120445 TGAATAACCACTGGGGACAAAGG No data
1158739203_1158739210 23 Left 1158739203 18:60120377-60120399 CCCTCTAATGCTATCACATGTTT No data
Right 1158739210 18:60120423-60120445 TGAATAACCACTGGGGACAAAGG No data
1158739204_1158739210 22 Left 1158739204 18:60120378-60120400 CCTCTAATGCTATCACATGTTTA No data
Right 1158739210 18:60120423-60120445 TGAATAACCACTGGGGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158739210 Original CRISPR TGAATAACCACTGGGGACAA AGG Intergenic
No off target data available for this crispr