ID: 1158741224

View in Genome Browser
Species Human (GRCh38)
Location 18:60144486-60144508
Sequence CTGGCTCCTGGCCATCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158741218_1158741224 2 Left 1158741218 18:60144461-60144483 CCTGAACATCTCACCGTGTAGAG No data
Right 1158741224 18:60144486-60144508 CTGGCTCCTGGCCATCTTGCTGG No data
1158741216_1158741224 10 Left 1158741216 18:60144453-60144475 CCATTTTCCCTGAACATCTCACC No data
Right 1158741224 18:60144486-60144508 CTGGCTCCTGGCCATCTTGCTGG No data
1158741215_1158741224 28 Left 1158741215 18:60144435-60144457 CCTACTAAAGTCACTTGGCCATT No data
Right 1158741224 18:60144486-60144508 CTGGCTCCTGGCCATCTTGCTGG No data
1158741217_1158741224 3 Left 1158741217 18:60144460-60144482 CCCTGAACATCTCACCGTGTAGA No data
Right 1158741224 18:60144486-60144508 CTGGCTCCTGGCCATCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158741224 Original CRISPR CTGGCTCCTGGCCATCTTGC TGG Intergenic
No off target data available for this crispr