ID: 1158741556

View in Genome Browser
Species Human (GRCh38)
Location 18:60148323-60148345
Sequence ATATTTCAGAACCTCTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158741555_1158741556 1 Left 1158741555 18:60148299-60148321 CCACAGTGCTGCAAAATACAGAT No data
Right 1158741556 18:60148323-60148345 ATATTTCAGAACCTCTTTATTGG No data
1158741553_1158741556 26 Left 1158741553 18:60148274-60148296 CCTCCAGCTCTGACGAGCTGTGA No data
Right 1158741556 18:60148323-60148345 ATATTTCAGAACCTCTTTATTGG No data
1158741554_1158741556 23 Left 1158741554 18:60148277-60148299 CCAGCTCTGACGAGCTGTGAATC No data
Right 1158741556 18:60148323-60148345 ATATTTCAGAACCTCTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158741556 Original CRISPR ATATTTCAGAACCTCTTTAT TGG Intergenic
No off target data available for this crispr