ID: 1158746208

View in Genome Browser
Species Human (GRCh38)
Location 18:60202535-60202557
Sequence GAGGGTAGCAAGGAGCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158746208_1158746210 -10 Left 1158746208 18:60202535-60202557 CCTGCATGCTCCTTGCTACCCTC No data
Right 1158746210 18:60202548-60202570 TGCTACCCTCTTGTCTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158746208 Original CRISPR GAGGGTAGCAAGGAGCATGC AGG (reversed) Intergenic
No off target data available for this crispr