ID: 1158746942

View in Genome Browser
Species Human (GRCh38)
Location 18:60211825-60211847
Sequence GCCTCCAAAAAAGTAGCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158746942_1158746943 10 Left 1158746942 18:60211825-60211847 CCATAGGCTACTTTTTTGGAGGC No data
Right 1158746943 18:60211858-60211880 TTTAGTGTGAAGCTTATCACTGG No data
1158746942_1158746944 19 Left 1158746942 18:60211825-60211847 CCATAGGCTACTTTTTTGGAGGC No data
Right 1158746944 18:60211867-60211889 AAGCTTATCACTGGTTCTGCTGG No data
1158746942_1158746945 22 Left 1158746942 18:60211825-60211847 CCATAGGCTACTTTTTTGGAGGC No data
Right 1158746945 18:60211870-60211892 CTTATCACTGGTTCTGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158746942 Original CRISPR GCCTCCAAAAAAGTAGCCTA TGG (reversed) Intergenic
No off target data available for this crispr